Regulon of BirA in Macrococcus caseolyticus JCSC5402

Properties
Regulator type:	Transcription factor
TF locus tag:	MCCL_1104
Regulator family:	BirA
Regulation mode:	repressor
Biological process:	Biotin biosynthesis
Effector:	Biotin
Regulog:	BirA - Staphylococcaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - BirA
By TF family - BirA
By effector - Biotin
By pathway - Biotin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -75 Score: 6.7 Sequence: ATTGTTAACTTTTTGTACTAAAAGGTTAACGAA Locus tag: MCCL_0134 Name: bioY Funciton: biotin transporter BioY
	MCCL_0134	bioY	biotin transporter BioY
Position: -76 Score: 6.8 Sequence: ATTGTTAACTTATATTCAAAATTAGTTTACAAT Locus tag: MCCL_0376 Name: bioB Funciton: biotin synthase
	MCCL_0376	bioB	biotin synthase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD