Regulon of BirA in Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Properties
Regulator type:	Transcription factor
TF locus tag:	SSP1288
Regulator family:	BirA
Regulation mode:	repressor
Biological process:	Biotin biosynthesis
Effector:	Biotin
Regulog:	BirA - Staphylococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - BirA
By TF family - BirA
By effector - Biotin
By pathway - Biotin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 6.6 Sequence: AATGTTAACATATTTGTTATGAAGGTTAACAAA Locus tag: SSP2146 Name: yhfT Funciton: putative long chain fatty acid-CoA ligase Locus tag: SSP2145 Name: yhfS Funciton: putative acetyl-CoA c-acetyltransferase Locus tag: SSP2144 Name: SA0535 Funciton: hypothetical protein Locus tag: SSP2143 Name: SA0536 Funciton: hypothetical protein
	SSP2146	yhfT	putative long chain fatty acid-CoA ligase
	SSP2145	yhfS	putative acetyl-CoA c-acetyltransferase
	SSP2144	SA0535	hypothetical protein
	SSP2143	SA0536	hypothetical protein
Position: -67 Score: 8.1 Sequence: AATGTAAACTTTTTATTTTTTAAAGTTTACATT Locus tag: SSP0625 Name: bioY Funciton: biotin transporter BioY Locus tag: SSP0626 Name: SA2076 Funciton: putative acetyltransferase
	SSP0625	bioY	biotin transporter BioY
	SSP0626	SA2076	putative acetyltransferase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD