Regulon of BirA in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type:	Transcription factor
TF locus tag:	SA1289
Regulator family:	BirA
Regulation mode:	repressor
Biological process:	Biotin biosynthesis
Effector:	Biotin
Regulog:	BirA - Staphylococcaceae
Statistics of regulated genes:
- Genes	12
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - BirA
By TF family - BirA
By effector - Biotin
By pathway - Biotin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -48 Score: 7.1 Sequence: AATGTTAACAAGATGTATTTTAAAGTTTACATT Locus tag: SA0533 Name: yhfT Funciton: putative long chain fatty acid-CoA ligase Locus tag: SA0534 Name: yhfS Funciton: putative acetyl-CoA c-acetyltransferase Locus tag: SA0535 Name: SA0535 Funciton: hypothetical protein Locus tag: SA0536 Name: SA0536 Funciton: hypothetical protein
	SA0533	yhfT	putative long chain fatty acid-CoA ligase
	SA0534	yhfS	putative acetyl-CoA c-acetyltransferase
	SA0535	SA0535	hypothetical protein
	SA0536	SA0536	hypothetical protein
Position: -75 Score: 7.5 Sequence: ATTGTAAACTTTTCATTTCTTAAAGTTTACAAT Locus tag: SA2077 Name: bioY Funciton: biotin transporter BioY Locus tag: SA2076 Name: SA2076 Funciton: putative acetyltransferase
	SA2077	bioY	biotin transporter BioY
	SA2076	SA2076	putative acetyltransferase
Position: -55 Score: 7.9 Sequence: AATGTAAACTTATTAATTATAAAAGTTTACATT Locus tag: SA2215 Name: bioD Funciton: dethiobiotin synthetase Locus tag: SA2214 Name: bioA Funciton: adenosylmethionine-8-amino-7-oxononanoate aminotransferase Locus tag: SA2213 Name: bioB Funciton: biotin synthase Locus tag: SA2212 Name: bioF Funciton: hypothetical protein Locus tag: SA2211 Name: bioW Funciton: hypothetical protein Locus tag: SA2210 Name: bioX Funciton: hypothetical protein
	SA2215	bioD	dethiobiotin synthetase
	SA2214	bioA	adenosylmethionine-8-amino-7-oxononanoate aminotransferase
	SA2213	bioB	biotin synthase
	SA2212	bioF	hypothetical protein
	SA2211	bioW	hypothetical protein
	SA2210	bioX	hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD