Regulog PaaR - Micrococcineae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Phenylacetic acid degradation |
| Effector: | Phenylacetyl-CoA |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Micrococcineae
- By trascription factor - PaaR
- By TF family - TetR
- By effector - Phenylacetyl-CoA
- By pathway - Phenylacetic acid degradation
| Genome | Genes | Operons |
|---|---|---|
| Arthrobacter aurescens TC1 | 13 | 5 |
| Arthrobacter chlorophenolicus A6 | 14 | 7 |
| Arthrobacter sp. FB24 | 15 | 7 |
| Beutenbergia cavernae DSM 12333 | ||
| Brachybacterium faecium DSM 4810 | ||
| Brevibacterium linens BL2 | 14 | 4 |
| Clavibacter michiganensis subsp. michiganensis NCPPB 382 | ||
| Janibacter sp. HTCC2649 | ||
| Jonesia denitrificans DSM 20603 | ||
| Kocuria rhizophila DC2201 | 11 | 5 |
| Kytococcus sedentarius DSM 20547 | ||
| Leifsonia xyli subsp. xyli str. CTCB07 | ||
| Renibacterium salmoninarum ATCC 33209 | 12 | 3 |
| Tropheryma whipplei str. Twist |
| Genes | Function | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||
| paaA |
*
Arthrobacter aurescens TC1 Site: position = -36 score = 5.5853 sequence = TCTGAACGAACGGTCGGTAATT Gene: AAur_3226: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Arthrobacter chlorophenolicus A6 Site: position = -64 score = 5.48047 sequence = CCTGAACGAACGGTCGGTAAAT Gene: Achl_2964: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Arthrobacter sp. FB24 Site: position = -49 score = 5.56542 sequence = CCTGAACGAACGGTCGGTAATT Gene: Arth_3218: Phenylacetate-CoA oxygenase, PaaA subunit |
|
|
*
Brevibacterium linens BL2 Site: position = -101 score = 4.20209 sequence = ACAGAACAAATGGTCAGTAAAT Gene: BlinB01000722: Phenylacetate-CoA oxygenase, PaaA subunit |
|
|
|
*
Kocuria rhizophila DC2201 Site: position = -210 score = 5.01457 sequence = ATTTTCAGAACGATCGGTCAGT Site: position = -67 score = 4.80947 sequence = TCTGAACGAGCGGTCAGTTATT Gene: KRH_02150: Phenylacetate-CoA oxygenase, PaaA subunit |
Gene: Ksed_09290: Phenylacetate-CoA oxygenase, PaaA subunit |
|
*
Renibacterium salmoninarum ATCC 33209 Site: position = -66 score = 4.9379 sequence = ATATACTGAACGAACGGTCAGT Site: position = -62 score = 5.38967 sequence = ACTGAACGAACGGTCAGTAATT Gene: RSal33209_2662: Phenylacetate-CoA oxygenase, PaaA subunit |
|
Phenylacetate-CoA oxygenase, PaaA subunit |
| paaB |
Gene: AAur_3225: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: Achl_2963: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: Arth_3217: Phenylacetate-CoA oxygenase, PaaB subunit |
|
|
Gene: BlinB01000723: Phenylacetate-CoA oxygenase, PaaB subunit |
|
|
|
Gene: KRH_02140: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: Ksed_09300: Phenylacetate-CoA oxygenase, PaaB subunit |
|
Gene: RSal33209_2661: Phenylacetate-CoA oxygenase, PaaB subunit |
|
Phenylacetate-CoA oxygenase, PaaB subunit |
| paaC |
Gene: AAur_3224: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: Achl_2962: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: Arth_3216: Phenylacetate-CoA oxygenase, PaaC subunit |
|
|
Gene: BlinB01000724: Phenylacetate-CoA oxygenase, PaaC subunit |
|
|
|
Gene: KRH_02130: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: Ksed_09310: Phenylacetate-CoA oxygenase, PaaC subunit |
|
Gene: RSal33209_2660: Phenylacetate-CoA oxygenase, PaaC subunit |
|
Phenylacetate-CoA oxygenase, PaaC subunit |
| paaD |
Gene: AAur_3223: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: Achl_2961: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: Arth_3215: Phenylacetate-CoA oxygenase, PaaD subunit |
|
|
Gene: BlinB01000725: Phenylacetate-CoA oxygenase, PaaD subunit |
|
|
|
Gene: KRH_02120: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: Ksed_09320: Phenylacetate-CoA oxygenase, PaaD subunit |
|
Gene: RSal33209_2659: Phenylacetate-CoA oxygenase, PaaD subunit |
|
Phenylacetate-CoA oxygenase, PaaD subunit |
| paaE |
Gene: AAur_3222: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: Achl_2960: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: Arth_3214: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
|
|
Gene: BlinB01000726: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
|
|
|
Gene: KRH_02110: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: Ksed_09330: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
|
Gene: RSal33209_2658: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
|
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
| paaJ |
*
Arthrobacter aurescens TC1 Site: position = -63 score = 4.68486 sequence = ATAGAACGAACGGTCGGTATAT Gene: AAur_3260: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
*
Arthrobacter chlorophenolicus A6 Site: position = -83 score = 5.55788 sequence = ACAGAACGAACGGTCGGTAAGT Site: position = -87 score = 5.23596 sequence = ATTTACAGAACGAACGGTCGGT Gene: Achl_3063: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
*
Arthrobacter sp. FB24 Site: position = -83 score = 5.09372 sequence = ATAGAACGAACGGTCGGTAAAT Gene: Arth_3268: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
|
|
Gene: BlinB01000727: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
|
|
|
Gene: KRH_02300: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
|
|
*
Renibacterium salmoninarum ATCC 33209 Site: position = -46 score = 4.74155 sequence = ATTGAACGATTGGTCAGTAAAT Gene: RSal33209_2690: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
|
Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
| paaF |
Gene: AAur_3259: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: Achl_3062: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: Arth_3267: Enoyl-CoA hydratase (EC 4.2.1.17) |
|
|
Gene: BlinB01000728: Enoyl-CoA hydratase (EC 4.2.1.17) |
|
|
|
Gene: KRH_02290: Enoyl-CoA hydratase (EC 4.2.1.17) |
|
|
Gene: RSal33209_2689: Enoyl-CoA hydratase (EC 4.2.1.17) |
|
Enoyl-CoA hydratase (EC 4.2.1.17) |
| paaH |
Gene: AAur_3258: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
Gene: Achl_3061: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
Gene: Arth_3266: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
|
|
Gene: BlinB01000729: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
|
|
|
Gene: KRH_02280: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
|
|
Gene: RSal33209_2688: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
|
3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
| paaG |
Gene: AAur_3221: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: Achl_2959: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: Arth_3213: Enoyl-CoA hydratase (EC 4.2.1.17) |
|
|
Gene: BlinB01000730: Enoyl-CoA hydratase (EC 4.2.1.17) |
|
|
|
Gene: KRH_02100: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: Ksed_19430: Enoyl-CoA hydratase (EC 4.2.1.17) |
|
Gene: RSal33209_2657: Enoyl-CoA hydratase (EC 4.2.1.17) |
|
Enoyl-CoA hydratase (EC 4.2.1.17) |
| CRON 2. | |||||||||||||||
| paaT |
*
Arthrobacter aurescens TC1 Site: position = -70 score = 5.13094 sequence = CCTAACTGACCGTTCTGTCGGT Gene: AAur_2544: Predicted phylacetic acid transporter PaaT |
*
Arthrobacter chlorophenolicus A6 Site: position = -73 score = 5.33 sequence = ACCAACTGACCGTTCTGTCGGT Gene: Achl_2302: Predicted phylacetic acid transporter PaaT |
*
Arthrobacter sp. FB24 Site: position = -87 score = 5.70611 sequence = ACTGACCGTTCGATCGGTAATT Gene: Arth_2568: Predicted phylacetic acid transporter PaaT |
|
|
*
Brevibacterium linens BL2 Site: position = -191 score = 5.47491 sequence = ACTAACCAATCGGTCGGTTATT Gene: BlinB01000710: Predicted phylacetic acid transporter PaaT |
|
|
|
*
Kocuria rhizophila DC2201 Site: position = -81 score = 4.59608 sequence = CAAGACCAATCGGTCGGTAAAT Gene: KRH_02310: Predicted phylacetic acid transporter PaaT |
|
|
Gene: RSal33209_1501: Predicted phylacetic acid transporter PaaT |
|
Predicted phylacetic acid transporter PaaT |
| CRON 3. | |||||||||||||||
| paaI |
*
Arthrobacter aurescens TC1 Site: position = -42 score = 5.12582 sequence = ACCTAATGAACATTCGGTAAAT Gene: AAur_3243: Phenylacetic acid degradation protein PaaI, thioesterase |
*
Arthrobacter chlorophenolicus A6 Site: position = -42 score = 5.12582 sequence = ACCTAATGAACATTCGGTAAAT Gene: Achl_3047: Phenylacetic acid degradation protein PaaI, thioesterase |
*
Arthrobacter sp. FB24 Site: position = -42 score = 5.12582 sequence = ACCTAATGAACATTCGGTAAAT Gene: Arth_3246: Phenylacetic acid degradation protein PaaI, thioesterase |
|
|
*
Brevibacterium linens BL2 Site: position = -138 score = 4.43893 sequence = ATTGACCAGATGGTCGTTTATT Gene: BlinB01000721: Phenylacetic acid degradation protein PaaI, thioesterase |
|
|
|
*
Kocuria rhizophila DC2201 Site: position = -38 score = 5.01457 sequence = ACTGACCGATCGTTCTGAAAAT Site: position = -181 score = 4.80947 sequence = AATAACTGACCGCTCGTTCAGA Gene: KRH_02160: Phenylacetic acid degradation protein PaaI, thioesterase |
|
|
Gene: RSal33209_2672: Phenylacetic acid degradation protein PaaI, thioesterase |
|
Phenylacetic acid degradation protein PaaI, thioesterase |
| paaK |
Gene: AAur_3244: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: Achl_3048: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: Arth_3247: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
|
|
Gene: BlinB01000720: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
|
|
|
Gene: KRH_02170: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
|
|
Gene: RSal33209_2673: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
|
Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
| paaR |
|
*
Arthrobacter chlorophenolicus A6 Site: position = -32 score = 4.57995 sequence = GCTGACCGACCGTTCGTGAGAA Gene: Achl_3049: transcriptional regulator, TetR family |
*
Arthrobacter sp. FB24 Site: position = -32 score = 4.35886 sequence = ATTGACCGAACGTTCATGAGAA Gene: Arth_3248: transcriptional regulator, TetR family |
|
|
Gene: BlinB01000719: transcriptional regulator, TetR family |
|
|
|
Gene: KRH_02180: transcriptional regulator, TetR family |
|
|
Gene: RSal33209_2674: transcriptional regulator, TetR family |
|
transcriptional regulator, TetR family |
| CRON 4. | |||||||||||||||
| paaY |
|
*
Arthrobacter chlorophenolicus A6 Site: position = -70 score = 4.55059 sequence = GATTACTGACCGTCCGTTCGGT Site: position = -66 score = 5.62733 sequence = ACTGACCGTCCGTTCGGTAATA Gene: Achl_3054: putative thioesterase family domain protein |
*
Arthrobacter sp. FB24 Site: position = -132 score = 4.5818 sequence = CATTACTGACCGTCCGTTCGGT Site: position = -128 score = 5.62733 sequence = ACTGACCGTCCGTTCGGTAATA Gene: Arth_3256: putative thioesterase family domain protein |
|
|
|
|
|
|
*
Kocuria rhizophila DC2201 Site: position = -268 score = 5.25846 sequence = GTTAGCCGAACGATCGGTCAGT Site: position = -264 score = 4.23055 sequence = GCCGAACGATCGGTCAGTATTG Gene: KRH_02210: putative thioesterase family domain protein |
|
|
|
|
putative thioesterase family domain protein |
| CRON 5. | |||||||||||||||
| RSal33209_2682 |
|
|
|
|
|
|
|
|
|
|
|
|
*
Renibacterium salmoninarum ATCC 33209 Site: position = -91 score = 4.8245 sequence = AATTACTGACCACTCGTTCAGT Gene: RSal33209_2682: 2-hydroxyphenylacetyl-CoA ring opening enzyme |
|
2-hydroxyphenylacetyl-CoA ring opening enzyme |
| paaZ |
*
Arthrobacter aurescens TC1 Site: position = -61 score = 5.4321 sequence = TATTACCGAACGGCCGGTCAGT Gene: AAur_3246: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
*
Arthrobacter chlorophenolicus A6 Site: position = -82 score = 5.62733 sequence = TATTACCGAACGGACGGTCAGT Gene: Achl_3053: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
*
Arthrobacter sp. FB24 Site: position = -72 score = 5.62733 sequence = TATTACCGAACGGACGGTCAGT Gene: Arth_3255: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
|
|
*
Brevibacterium linens BL2 Site: position = -101 score = 5.47491 sequence = AATAACCGACCGATTGGTTAGT Gene: BlinB01000711: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
|
|
|
*
Kocuria rhizophila DC2201 Site: position = -48 score = 5.25846 sequence = ACTGACCGATCGTTCGGCTAAC Gene: KRH_02200: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
|
|
2
Renibacterium salmoninarum ATCC 33209 Gene: RSal33209_2680: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ Gene: RSal33209_2681: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
|
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |