Regulon of PaaR in Renibacterium salmoninarum ATCC 33209

Properties
Regulator type:	Transcription factor
TF locus tag:	RSal33209_2673
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Micrococcineae
Statistics of regulated genes:
- Genes	12
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 38 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 4.9 Sequence: ATATACTGAACGAACGGTCAGT Position: -62 Score: 5.4 Sequence: ACTGAACGAACGGTCAGTAATT Locus tag: RSal33209_2662 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: RSal33209_2661 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: RSal33209_2660 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: RSal33209_2659 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: RSal33209_2658 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: RSal33209_2657 Name: paaG Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
	RSal33209_2662	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	RSal33209_2661	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	RSal33209_2660	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	RSal33209_2659	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	RSal33209_2658	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	RSal33209_2657	paaG	Enoyl-CoA hydratase (EC 4.2.1.17)
Position: -46 Score: 4.7 Sequence: ATTGAACGATTGGTCAGTAAAT Locus tag: RSal33209_2690 Name: paaJ Funciton: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) Locus tag: RSal33209_2689 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: RSal33209_2688 Name: paaH Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
	RSal33209_2690	paaJ	Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
	RSal33209_2689	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	RSal33209_2688	paaH	3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
Position: -91 Score: 4.8 Sequence: AATTACTGACCACTCGTTCAGT Locus tag: RSal33209_2682 Name: null Funciton: 2-hydroxyphenylacetyl-CoA ring opening enzyme Locus tag: RSal33209_2681 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ Locus tag: RSal33209_2680 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	RSal33209_2682		2-hydroxyphenylacetyl-CoA ring opening enzyme
	RSal33209_2681	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	RSal33209_2680	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD