Regulon of PaaR in Kocuria rhizophila DC2201

Properties
Regulator type:	Transcription factor
TF locus tag:	KRH_02180
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Micrococcineae
Statistics of regulated genes:
- Genes	11
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 38 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -268 Score: 5.3 Sequence: GTTAGCCGAACGATCGGTCAGT Position: -264 Score: 4.2 Sequence: GCCGAACGATCGGTCAGTATTG Locus tag: KRH_02210 Name: paaY Funciton: putative thioesterase family domain protein
	KRH_02210	paaY	putative thioesterase family domain protein
Position: -210 Score: 5 Sequence: ATTTTCAGAACGATCGGTCAGT Position: -67 Score: 4.8 Sequence: TCTGAACGAGCGGTCAGTTATT Locus tag: KRH_02150 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: KRH_02140 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: KRH_02130 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: KRH_02120 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: KRH_02110 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	KRH_02150	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	KRH_02140	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	KRH_02130	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	KRH_02120	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	KRH_02110	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Position: -181 Score: 4.8 Sequence: AATAACTGACCGCTCGTTCAGA Position: -38 Score: 5 Sequence: ACTGACCGATCGTTCTGAAAAT Locus tag: KRH_02160 Name: paaI Funciton: Phenylacetic acid degradation protein PaaI, thioesterase Locus tag: KRH_02170 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) Locus tag: KRH_02180 Name: paaR Funciton: transcriptional regulator, TetR family
	KRH_02160	paaI	Phenylacetic acid degradation protein PaaI, thioesterase
	KRH_02170	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	KRH_02180	paaR	transcriptional regulator, TetR family
Position: -81 Score: 4.6 Sequence: CAAGACCAATCGGTCGGTAAAT Locus tag: KRH_02310 Name: paaT Funciton: Predicted phylacetic acid transporter PaaT
	KRH_02310	paaT	Predicted phylacetic acid transporter PaaT
Position: -48 Score: 5.3 Sequence: ACTGACCGATCGTTCGGCTAAC Locus tag: KRH_02200 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	KRH_02200	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD