Regulon of PaaR in Arthrobacter sp. FB24

Properties
Regulator type:	Transcription factor
TF locus tag:	Arth_3248
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Micrococcineae
Statistics of regulated genes:
- Genes	15
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 38 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -87 Score: 5.7 Sequence: ACTGACCGTTCGATCGGTAATT Locus tag: Arth_2568 Name: paaT Funciton: Predicted phylacetic acid transporter PaaT
	Arth_2568	paaT	Predicted phylacetic acid transporter PaaT
Position: -132 Score: 4.6 Sequence: CATTACTGACCGTCCGTTCGGT Position: -128 Score: 5.6 Sequence: ACTGACCGTCCGTTCGGTAATA Locus tag: Arth_3256 Name: paaY Funciton: putative thioesterase family domain protein
	Arth_3256	paaY	putative thioesterase family domain protein
Position: -49 Score: 5.6 Sequence: CCTGAACGAACGGTCGGTAATT Locus tag: Arth_3218 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: Arth_3217 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: Arth_3216 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: Arth_3215 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: Arth_3214 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: Arth_3213 Name: paaG Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
	Arth_3218	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	Arth_3217	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	Arth_3216	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	Arth_3215	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	Arth_3214	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	Arth_3213	paaG	Enoyl-CoA hydratase (EC 4.2.1.17)
Position: -83 Score: 5.1 Sequence: ATAGAACGAACGGTCGGTAAAT Locus tag: Arth_3268 Name: paaJ Funciton: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) Locus tag: Arth_3267 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: Arth_3266 Name: paaH Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
	Arth_3268	paaJ	Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
	Arth_3267	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	Arth_3266	paaH	3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
Position: -32 Score: 4.4 Sequence: ATTGACCGAACGTTCATGAGAA Locus tag: Arth_3248 Name: paaR Funciton: transcriptional regulator, TetR family
	Arth_3248	paaR	transcriptional regulator, TetR family
Position: -42 Score: 5.1 Sequence: ACCTAATGAACATTCGGTAAAT Locus tag: Arth_3246 Name: paaI Funciton: Phenylacetic acid degradation protein PaaI, thioesterase Locus tag: Arth_3247 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	Arth_3246	paaI	Phenylacetic acid degradation protein PaaI, thioesterase
	Arth_3247	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Position: -72 Score: 5.6 Sequence: TATTACCGAACGGACGGTCAGT Locus tag: Arth_3255 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	Arth_3255	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of PaaR in Arthrobacter sp. FB24

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --