Regulon of PaaR in Arthrobacter aurescens TC1

Properties
Regulator type:	Transcription factor
TF locus tag:
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Micrococcineae
Statistics of regulated genes:
- Genes	13
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 38 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -36 Score: 5.6 Sequence: TCTGAACGAACGGTCGGTAATT Locus tag: AAur_3226 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: AAur_3225 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: AAur_3224 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: AAur_3223 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: AAur_3222 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: AAur_3221 Name: paaG Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
	AAur_3226	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	AAur_3225	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	AAur_3224	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	AAur_3223	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	AAur_3222	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	AAur_3221	paaG	Enoyl-CoA hydratase (EC 4.2.1.17)
Position: -63 Score: 4.7 Sequence: ATAGAACGAACGGTCGGTATAT Locus tag: AAur_3260 Name: paaJ Funciton: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) Locus tag: AAur_3259 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: AAur_3258 Name: paaH Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
	AAur_3260	paaJ	Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
	AAur_3259	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	AAur_3258	paaH	3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
Position: -42 Score: 5.1 Sequence: ACCTAATGAACATTCGGTAAAT Locus tag: AAur_3243 Name: paaI Funciton: Phenylacetic acid degradation protein PaaI, thioesterase Locus tag: AAur_3244 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	AAur_3243	paaI	Phenylacetic acid degradation protein PaaI, thioesterase
	AAur_3244	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Position: -70 Score: 5.1 Sequence: CCTAACTGACCGTTCTGTCGGT Locus tag: AAur_2544 Name: paaT Funciton: Predicted phylacetic acid transporter PaaT
	AAur_2544	paaT	Predicted phylacetic acid transporter PaaT
Position: -61 Score: 5.4 Sequence: TATTACCGAACGGCCGGTCAGT Locus tag: AAur_3246 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	AAur_3246	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD