Regulon of PaaR in Arthrobacter chlorophenolicus A6

Properties
Regulator type:	Transcription factor
TF locus tag:	Achl_3049
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Micrococcineae
Statistics of regulated genes:
- Genes	14
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 38 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -73 Score: 5.3 Sequence: ACCAACTGACCGTTCTGTCGGT Locus tag: Achl_2302 Name: paaT Funciton: Predicted phylacetic acid transporter PaaT
	Achl_2302	paaT	Predicted phylacetic acid transporter PaaT
Position: -64 Score: 5.5 Sequence: CCTGAACGAACGGTCGGTAAAT Locus tag: Achl_2964 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: Achl_2963 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: Achl_2962 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: Achl_2961 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: Achl_2960 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	Achl_2964	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	Achl_2963	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	Achl_2962	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	Achl_2961	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	Achl_2960	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Position: -87 Score: 5.2 Sequence: ATTTACAGAACGAACGGTCGGT Position: -83 Score: 5.6 Sequence: ACAGAACGAACGGTCGGTAAGT Locus tag: Achl_3063 Name: paaJ Funciton: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) Locus tag: Achl_3062 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: Achl_3061 Name: paaH Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
	Achl_3063	paaJ	Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
	Achl_3062	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	Achl_3061	paaH	3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
Position: -32 Score: 4.6 Sequence: GCTGACCGACCGTTCGTGAGAA Locus tag: Achl_3049 Name: paaR Funciton: transcriptional regulator, TetR family
	Achl_3049	paaR	transcriptional regulator, TetR family
Position: -42 Score: 5.1 Sequence: ACCTAATGAACATTCGGTAAAT Locus tag: Achl_3047 Name: paaI Funciton: Phenylacetic acid degradation protein PaaI, thioesterase Locus tag: Achl_3048 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	Achl_3047	paaI	Phenylacetic acid degradation protein PaaI, thioesterase
	Achl_3048	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Position: -82 Score: 5.6 Sequence: TATTACCGAACGGACGGTCAGT Locus tag: Achl_3053 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	Achl_3053	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
Position: -70 Score: 4.6 Sequence: GATTACTGACCGTCCGTTCGGT Position: -66 Score: 5.6 Sequence: ACTGACCGTCCGTTCGGTAATA Locus tag: Achl_3054 Name: paaY Funciton: putative thioesterase family domain protein
	Achl_3054	paaY	putative thioesterase family domain protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of PaaR in Arthrobacter chlorophenolicus A6

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --