Regulon of PaaR in Brevibacterium linens BL2

Properties
Regulator type:	Transcription factor
TF locus tag:	BlinB01000719
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Micrococcineae
Statistics of regulated genes:
- Genes	14
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 38 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -101 Score: 4.2 Sequence: ACAGAACAAATGGTCAGTAAAT Locus tag: BlinB01000722 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: BlinB01000723 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: BlinB01000724 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: BlinB01000725 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: BlinB01000726 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: BlinB01000727 Name: paaJ Funciton: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) Locus tag: BlinB01000728 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: BlinB01000729 Name: paaH Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) Locus tag: BlinB01000730 Name: paaG Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
	BlinB01000722	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	BlinB01000723	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	BlinB01000724	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	BlinB01000725	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	BlinB01000726	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	BlinB01000727	paaJ	Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
	BlinB01000728	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	BlinB01000729	paaH	3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
	BlinB01000730	paaG	Enoyl-CoA hydratase (EC 4.2.1.17)
Position: -138 Score: 4.4 Sequence: ATTGACCAGATGGTCGTTTATT Locus tag: BlinB01000721 Name: paaI Funciton: Phenylacetic acid degradation protein PaaI, thioesterase Locus tag: BlinB01000720 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) Locus tag: BlinB01000719 Name: paaR Funciton: transcriptional regulator, TetR family
	BlinB01000721	paaI	Phenylacetic acid degradation protein PaaI, thioesterase
	BlinB01000720	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	BlinB01000719	paaR	transcriptional regulator, TetR family
Position: -191 Score: 5.5 Sequence: ACTAACCAATCGGTCGGTTATT Locus tag: BlinB01000710 Name: paaT Funciton: Predicted phylacetic acid transporter PaaT
	BlinB01000710	paaT	Predicted phylacetic acid transporter PaaT
Position: -101 Score: 5.5 Sequence: AATAACCGACCGATTGGTTAGT Locus tag: BlinB01000711 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	BlinB01000711	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD