Statistics of regulated genes

Genome	Genes	Operons
Mycobacterium smegmatis str. MC2 155	3	2
Mycobacterium marinum M	2	2
Mycobacterium leprae TN
Mycobacterium flavescens PYR-GCK	4	2
Mycobacterium avium 104	2	1
Mycobacterium abscessus ATCC 19977	1	1
Mycobacterium sp. JLS	3	2
Mycobacterium tuberculosis H37Rv	1	1
Mycobacterium vanbaalenii PYR-1	4	2

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes										Function
CRON 1.
mtsA	Mycobacterium smegmatis str. MC2 155	Mycobacterium marinum M	Mycobacterium leprae TN	* Mycobacterium flavescens PYR-GCK Site: position = -35 score = 4.88737 sequence = AGTTTCGGCGACCCGAAATC Gene: Mflv_3168: Manganese ABC transporter, substrate-binding protein	Mycobacterium avium 104	Mycobacterium abscessus ATCC 19977	Mycobacterium sp. JLS	Mycobacterium tuberculosis H37Rv	* Mycobacterium vanbaalenii PYR-1 Site: position = -61 score = 5.25207 sequence = GTTTTCGGTCACCCAAACTT Gene: Mvan_3371: Manganese ABC transporter, substrate-binding protein	Manganese ABC transporter, substrate-binding protein
mtsB	Mycobacterium smegmatis str. MC2 155	Mycobacterium marinum M	Mycobacterium leprae TN	Mycobacterium flavescens PYR-GCK Gene: Mflv_3167: Manganese ABC transporter, ATP-binding protein	Mycobacterium avium 104	Mycobacterium abscessus ATCC 19977	Mycobacterium sp. JLS	Mycobacterium tuberculosis H37Rv	Mycobacterium vanbaalenii PYR-1 Gene: Mvan_3370: Manganese ABC transporter, ATP-binding protein	Manganese ABC transporter, ATP-binding protein
mtsC	Mycobacterium smegmatis str. MC2 155	Mycobacterium marinum M	Mycobacterium leprae TN	Mycobacterium flavescens PYR-GCK Gene: Mflv_3166: Manganese ABC transporter, substrate-binding protein	Mycobacterium avium 104	Mycobacterium abscessus ATCC 19977	Mycobacterium sp. JLS	Mycobacterium tuberculosis H37Rv	Mycobacterium vanbaalenii PYR-1 Gene: Mvan_3369: Manganese ABC transporter, substrate-binding protein	Manganese ABC transporter, substrate-binding protein
CRON 2.
mntH	* Mycobacterium smegmatis str. MC2 155 Site: position = -53 score = 6.84888 sequence = GATTTCGGCTAACCTAACTT Gene: MSMEG_5589: Manganese transport protein MntH	* Mycobacterium marinum M Site: position = -54 score = 5.50927 sequence = TGTTTCGGCTAGCCTCACTT Gene: MMAR_4584: Manganese transport protein MntH	Mycobacterium leprae TN Gene: ML2098: Manganese transport protein MntH	* Mycobacterium flavescens PYR-GCK Site: position = -54 score = 6.11247 sequence = GGTTTCGTCTGGCCTAACTT Gene: Mflv_1822: Manganese transport protein MntH	* Mycobacterium avium 104 Site: position = -52 score = 4.63707 sequence = ATGTTCGACTACCCTCACTT Gene: MAV_1044: Manganese transport protein MntH	* Mycobacterium abscessus ATCC 19977 Site: position = -53 score = 5.39578 sequence = AGTTTCGGCTACTCTAACTT Gene: MAB_1031c: Manganese transport protein MntH	* Mycobacterium sp. JLS Site: position = -51 score = 6.66303 sequence = GTTTTCGGCTAACCTAACTT Gene: Mjls_4747: Manganese transport protein MntH	Mycobacterium tuberculosis H37Rv Gene: Rv0924c: Manganese transport protein MntH	Mycobacterium vanbaalenii PYR-1	Manganese transport protein MntH
PF05908	Mycobacterium smegmatis str. MC2 155 Gene: MSMEG_5591: Protein of unknown function DUF867	Mycobacterium marinum M	Mycobacterium leprae TN	Mycobacterium flavescens PYR-GCK	Mycobacterium avium 104 Gene: MAV_1043: Protein of unknown function DUF867	Mycobacterium abscessus ATCC 19977	Mycobacterium sp. JLS Gene: Mjls_4748: Protein of unknown function DUF867	Mycobacterium tuberculosis H37Rv Gene: Rv0923c: Protein of unknown function DUF867	Mycobacterium vanbaalenii PYR-1	Protein of unknown function DUF867
CRON 3.
COG2119	* Mycobacterium smegmatis str. MC2 155 Site: position = -311 score = 4.89847 sequence = AGTATCGGTTACCCGAACAT Gene: MSMEG_5329: Predicted manganese transporter, COG2119 family	* Mycobacterium marinum M Site: position = -216 score = 4.5647 sequence = GGATACGGCCGCCCGAACTT Gene: MMAR_5398: Predicted manganese transporter, COG2119 family	Mycobacterium leprae TN	Mycobacterium flavescens PYR-GCK Gene: Mflv_2016: Predicted manganese transporter, COG2119 family	Mycobacterium avium 104	Mycobacterium abscessus ATCC 19977	* Mycobacterium sp. JLS Site: position = -218 score = 4.3256 sequence = GAATACGGCTGTCCGAAAAC Gene: Mjls_5425: Predicted manganese transporter, COG2119 family	* Mycobacterium tuberculosis H37Rv Site: position = -217 score = 4.62495 sequence = AAATACGGGTGGCCGAACTT Gene: Rv3848: Predicted manganese transporter, COG2119 family	* Mycobacterium vanbaalenii PYR-1 Site: position = -293 score = 5.19781 sequence = GTTTTGGGGTAGCCGAACTC Gene: Mvan_4708: Predicted manganese transporter, COG2119 family	Predicted manganese transporter, COG2119 family

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD