Regulog MntR - Mycobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Mycobacteriaceae
- By trascription factor - MntR
- By TF family - DtxR
- By effector - Manganese ion, (Mn2+)
- By pathway - Manganese homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Mycobacterium smegmatis str. MC2 155 | 3 | 2 |
| Mycobacterium marinum M | 2 | 2 |
| Mycobacterium leprae TN | ||
| Mycobacterium flavescens PYR-GCK | 4 | 2 |
| Mycobacterium avium 104 | 2 | 1 |
| Mycobacterium abscessus ATCC 19977 | 1 | 1 |
| Mycobacterium sp. JLS | 3 | 2 |
| Mycobacterium tuberculosis H37Rv | 1 | 1 |
| Mycobacterium vanbaalenii PYR-1 | 4 | 2 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| mtsA |
|
|
|
*
Mycobacterium flavescens PYR-GCK Site: position = -35 score = 4.88737 sequence = AGTTTCGGCGACCCGAAATC Gene: Mflv_3168: Manganese ABC transporter, substrate-binding protein |
|
|
|
|
*
Mycobacterium vanbaalenii PYR-1 Site: position = -61 score = 5.25207 sequence = GTTTTCGGTCACCCAAACTT Gene: Mvan_3371: Manganese ABC transporter, substrate-binding protein |
Manganese ABC transporter, substrate-binding protein |
| mtsB |
|
|
|
Gene: Mflv_3167: Manganese ABC transporter, ATP-binding protein |
|
|
|
|
Gene: Mvan_3370: Manganese ABC transporter, ATP-binding protein |
Manganese ABC transporter, ATP-binding protein |
| mtsC |
|
|
|
Gene: Mflv_3166: Manganese ABC transporter, substrate-binding protein |
|
|
|
|
Gene: Mvan_3369: Manganese ABC transporter, substrate-binding protein |
Manganese ABC transporter, substrate-binding protein |
| CRON 2. | ||||||||||
| mntH |
*
Mycobacterium smegmatis str. MC2 155 Site: position = -53 score = 6.84888 sequence = GATTTCGGCTAACCTAACTT Gene: MSMEG_5589: Manganese transport protein MntH |
*
Mycobacterium marinum M Site: position = -54 score = 5.50927 sequence = TGTTTCGGCTAGCCTCACTT Gene: MMAR_4584: Manganese transport protein MntH |
Gene: ML2098: Manganese transport protein MntH |
*
Mycobacterium flavescens PYR-GCK Site: position = -54 score = 6.11247 sequence = GGTTTCGTCTGGCCTAACTT Gene: Mflv_1822: Manganese transport protein MntH |
*
Mycobacterium avium 104 Site: position = -52 score = 4.63707 sequence = ATGTTCGACTACCCTCACTT Gene: MAV_1044: Manganese transport protein MntH |
*
Mycobacterium abscessus ATCC 19977 Site: position = -53 score = 5.39578 sequence = AGTTTCGGCTACTCTAACTT Gene: MAB_1031c: Manganese transport protein MntH |
*
Mycobacterium sp. JLS Site: position = -51 score = 6.66303 sequence = GTTTTCGGCTAACCTAACTT Gene: Mjls_4747: Manganese transport protein MntH |
Gene: Rv0924c: Manganese transport protein MntH |
|
Manganese transport protein MntH |
| PF05908 |
Gene: MSMEG_5591: Protein of unknown function DUF867 |
|
|
|
Gene: MAV_1043: Protein of unknown function DUF867 |
|
Gene: Mjls_4748: Protein of unknown function DUF867 |
Gene: Rv0923c: Protein of unknown function DUF867 |
|
Protein of unknown function DUF867 |
| CRON 3. | ||||||||||
| COG2119 |
*
Mycobacterium smegmatis str. MC2 155 Site: position = -311 score = 4.89847 sequence = AGTATCGGTTACCCGAACAT Gene: MSMEG_5329: Predicted manganese transporter, COG2119 family |
*
Mycobacterium marinum M Site: position = -216 score = 4.5647 sequence = GGATACGGCCGCCCGAACTT Gene: MMAR_5398: Predicted manganese transporter, COG2119 family |
|
Gene: Mflv_2016: Predicted manganese transporter, COG2119 family |
|
|
*
Mycobacterium sp. JLS Site: position = -218 score = 4.3256 sequence = GAATACGGCTGTCCGAAAAC Gene: Mjls_5425: Predicted manganese transporter, COG2119 family |
*
Mycobacterium tuberculosis H37Rv Site: position = -217 score = 4.62495 sequence = AAATACGGGTGGCCGAACTT Gene: Rv3848: Predicted manganese transporter, COG2119 family |
*
Mycobacterium vanbaalenii PYR-1 Site: position = -293 score = 5.19781 sequence = GTTTTGGGGTAGCCGAACTC Gene: Mvan_4708: Predicted manganese transporter, COG2119 family |
Predicted manganese transporter, COG2119 family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |