Regulon of MntR in Mycobacterium vanbaalenii PYR-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Mvan_2347
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Mycobacteriaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Mycobacteriaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -293 Score: 5.2 Sequence: GTTTTGGGGTAGCCGAACTC Locus tag: Mvan_4708 Name: COG2119 Funciton: Predicted manganese transporter, COG2119 family
	Mvan_4708	COG2119	Predicted manganese transporter, COG2119 family
Position: -61 Score: 5.3 Sequence: GTTTTCGGTCACCCAAACTT Locus tag: Mvan_3371 Name: mtsA Funciton: Manganese ABC transporter, substrate-binding protein Locus tag: Mvan_3370 Name: mtsB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: Mvan_3369 Name: mtsC Funciton: Manganese ABC transporter, substrate-binding protein
	Mvan_3371	mtsA	Manganese ABC transporter, substrate-binding protein
	Mvan_3370	mtsB	Manganese ABC transporter, ATP-binding protein
	Mvan_3369	mtsC	Manganese ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD