Regulon of MntR in Mycobacterium smegmatis str. MC2 155

Properties
Regulator type:	Transcription factor
TF locus tag:	MSMEG_2652
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Mycobacteriaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Mycobacteriaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -53 Score: 6.8 Sequence: GATTTCGGCTAACCTAACTT Locus tag: MSMEG_5589 Name: mntH Funciton: Manganese transport protein MntH Locus tag: MSMEG_5591 Name: PF05908 Funciton: Protein of unknown function DUF867
	MSMEG_5589	mntH	Manganese transport protein MntH
	MSMEG_5591	PF05908	Protein of unknown function DUF867
Position: -311 Score: 4.9 Sequence: AGTATCGGTTACCCGAACAT Locus tag: MSMEG_5329 Name: COG2119 Funciton: Predicted manganese transporter, COG2119 family
	MSMEG_5329	COG2119	Predicted manganese transporter, COG2119 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD