Regulon of MntR in Mycobacterium flavescens PYR-GCK

Properties
Regulator type:	Transcription factor
TF locus tag:	Mflv_4026
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Mycobacteriaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Mycobacteriaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 4.9 Sequence: AGTTTCGGCGACCCGAAATC Locus tag: Mflv_3168 Name: mtsA Funciton: Manganese ABC transporter, substrate-binding protein Locus tag: Mflv_3167 Name: mtsB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: Mflv_3166 Name: mtsC Funciton: Manganese ABC transporter, substrate-binding protein
	Mflv_3168	mtsA	Manganese ABC transporter, substrate-binding protein
	Mflv_3167	mtsB	Manganese ABC transporter, ATP-binding protein
	Mflv_3166	mtsC	Manganese ABC transporter, substrate-binding protein
Position: -54 Score: 6.1 Sequence: GGTTTCGTCTGGCCTAACTT Locus tag: Mflv_1822 Name: mntH Funciton: Manganese transport protein MntH
	Mflv_1822	mntH	Manganese transport protein MntH

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD