Regulon of MntR in Mycobacterium avium 104
| Regulator type: | Transcription factor |
| TF locus tag: | MAV_3679 |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Regulog: | MntR - Mycobacteriaceae |
| Statistics of regulated genes: | |
| - Genes | 2 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Mycobacteriaceae
- By trascription factor - MntR
- By TF family - DtxR
- By effector - Manganese ion, (Mn2+)
- By pathway - Manganese homeostasis
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -52
Score: 4.6 Sequence: ATGTTCGACTACCCTCACTT
Locus tag: MAV_1044
Name: mntH Funciton: Manganese transport protein MntH
Locus tag: MAV_1043
Name: PF05908 Funciton: Protein of unknown function DUF867 |
|||
|
mntH
|
Manganese transport protein MntH
|
||
|
PF05908
|
Protein of unknown function DUF867
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |