Regulon of MntR in Mycobacterium avium 104

Properties
Regulator type:	Transcription factor
TF locus tag:	MAV_3679
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Mycobacteriaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Mycobacteriaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 4.6 Sequence: ATGTTCGACTACCCTCACTT Locus tag: MAV_1044 Name: mntH Funciton: Manganese transport protein MntH Locus tag: MAV_1043 Name: PF05908 Funciton: Protein of unknown function DUF867
	MAV_1044	mntH	Manganese transport protein MntH
	MAV_1043	PF05908	Protein of unknown function DUF867

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD