Orthologous regulated operons containing mtsC gene

Built upon 13 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Mycobacterium flavescens PYR-GCK
Position: -35 Score: 4.88737 Sequence: AGTTTCGGCGACCCGAAATC Locus tag: Mflv_3168 Name: mtsA Funciton: Manganese ABC transporter, substrate-binding protein Locus tag: Mflv_3167 Name: mtsB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: Mflv_3166 Name: mtsC Funciton: Manganese ABC transporter, substrate-binding protein
mtsA-mtsB-mtsC	-35	4.9	AGTTTCGGCGACCCGAAATC	Mflv_3168
Mycobacterium vanbaalenii PYR-1
Position: -61 Score: 5.25207 Sequence: GTTTTCGGTCACCCAAACTT Locus tag: Mvan_3371 Name: mtsA Funciton: Manganese ABC transporter, substrate-binding protein Locus tag: Mvan_3370 Name: mtsB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: Mvan_3369 Name: mtsC Funciton: Manganese ABC transporter, substrate-binding protein
mtsA-mtsB-mtsC	-61	5.3	GTTTTCGGTCACCCAAACTT	Mvan_3371

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --