Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing mtsC gene

Properties
Regulog: MntR - Mycobacteriaceae
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Actinobacteria
Built upon 13 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Mycobacterium flavescens PYR-GCK
Position: -35
Score: 4.88737
Sequence: AGTTTCGGCGACCCGAAATC
Locus tag: Mflv_3168
Name: mtsA
Funciton: Manganese ABC transporter, substrate-binding protein
Locus tag: Mflv_3167
Name: mtsB
Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: Mflv_3166
Name: mtsC
Funciton: Manganese ABC transporter, substrate-binding protein
mtsA-mtsB-mtsC -35 4.9 AGTTTCGGCGACCCGAAATC Mflv_3168
Mycobacterium vanbaalenii PYR-1
Position: -61
Score: 5.25207
Sequence: GTTTTCGGTCACCCAAACTT
Locus tag: Mvan_3371
Name: mtsA
Funciton: Manganese ABC transporter, substrate-binding protein
Locus tag: Mvan_3370
Name: mtsB
Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: Mvan_3369
Name: mtsC
Funciton: Manganese ABC transporter, substrate-binding protein
mtsA-mtsB-mtsC -61 5.3 GTTTTCGGTCACCCAAACTT Mvan_3371