Regulon of MntR in Mycobacterium tuberculosis H37Rv

Properties
Regulator type:	Transcription factor
TF locus tag:	Rv2788
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Mycobacteriaceae
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Mycobacteriaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -217 Score: 4.6 Sequence: AAATACGGGTGGCCGAACTT Locus tag: Rv3848 Name: COG2119 Funciton: Predicted manganese transporter, COG2119 family
	Rv3848	COG2119	Predicted manganese transporter, COG2119 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD