Regulon of MntR in Mycobacterium tuberculosis H37Rv
| Regulator type: | Transcription factor |
| TF locus tag: | Rv2788 |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Regulog: | MntR - Mycobacteriaceae |
| Statistics of regulated genes: | |
| - Genes | 1 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Mycobacteriaceae
- By trascription factor - MntR
- By TF family - DtxR
- By effector - Manganese ion, (Mn2+)
- By pathway - Manganese homeostasis
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -217
Score: 4.6 Sequence: AAATACGGGTGGCCGAACTT
Locus tag: Rv3848
Name: COG2119 Funciton: Predicted manganese transporter, COG2119 family |
|||
|
COG2119
|
Predicted manganese transporter, COG2119 family
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |