Regulog PaaR - Nocardiaceae

Properties
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Phylum:	Actinobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Nocardiaceae
By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Statistics of regulated genes
Genome	Genes	Operons
Nocardia farcinica IFM 10152	15	4
Rhodococcus erythropolis PR4	10	3
Rhodococcus opacus B4	16	4
Rhodococcus sp. RHA1	16	5

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
paaJ	* Nocardia farcinica IFM 10152 Site: position = -49 score = 5.9106 sequence = ACTGACCGAATGTTCGGTAATA Gene: nfa21570: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)	Rhodococcus erythropolis PR4	* Rhodococcus opacus B4 Site: position = -148 score = 5.37147 sequence = TTTCACCGTACGTTCGGTCGGT Site: position = -53 score = 5.70362 sequence = ACCGACCGAAGATTCGGTTATT Gene: ROP_25860: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)	* Rhodococcus sp. RHA1 Site: position = -149 score = 5.37147 sequence = TTTCACCGTACGTTCGGTCGGT Site: position = -53 score = 5.70362 sequence = ACCGACCGAAGATTCGGTTATT Gene: RHA1_ro02863: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)	Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
paaF	Nocardia farcinica IFM 10152 Gene: nfa21580: Enoyl-CoA hydratase (EC 4.2.1.17)	Rhodococcus erythropolis PR4 Gene: RER_55530: Enoyl-CoA hydratase (EC 4.2.1.17)	Rhodococcus opacus B4 Gene: ROP_25850: Enoyl-CoA hydratase (EC 4.2.1.17)	Rhodococcus sp. RHA1 Gene: RHA1_ro02862: Enoyl-CoA hydratase (EC 4.2.1.17)	Enoyl-CoA hydratase (EC 4.2.1.17)
paaH	Nocardia farcinica IFM 10152 Gene: nfa21590: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)	Rhodococcus erythropolis PR4 Gene: RER_55520: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)	Rhodococcus opacus B4 Gene: ROP_25840: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)	Rhodococcus sp. RHA1 Gene: RHA1_ro02861: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)	3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
paaG	Nocardia farcinica IFM 10152 Gene: nfa21600: Enoyl-CoA hydratase (EC 4.2.1.17)	Rhodococcus erythropolis PR4 Gene: RER_55510: Enoyl-CoA hydratase (EC 4.2.1.17)	Rhodococcus opacus B4 Gene: ROP_25830: Enoyl-CoA hydratase (EC 4.2.1.17)	Rhodococcus sp. RHA1 Gene: RHA1_ro02860: Enoyl-CoA hydratase (EC 4.2.1.17)	Enoyl-CoA hydratase (EC 4.2.1.17)
paaA	Nocardia farcinica IFM 10152 Gene: nfa21610: Phenylacetate-CoA oxygenase, PaaA subunit	* Rhodococcus erythropolis PR4 Site: position = -35 score = 5.63991 sequence = ACCAACCGATCATTCGGTAATA Gene: RER_55500: Phenylacetate-CoA oxygenase, PaaA subunit	Rhodococcus opacus B4 Gene: ROP_25820: Phenylacetate-CoA oxygenase, PaaA subunit	* Rhodococcus sp. RHA1 Site: position = -34 score = 5.63991 sequence = ACCAACCGATCATTCGGTAATA Gene: RHA1_ro02859: Phenylacetate-CoA oxygenase, PaaA subunit	Phenylacetate-CoA oxygenase, PaaA subunit
paaB	Nocardia farcinica IFM 10152 Gene: nfa21620: Phenylacetate-CoA oxygenase, PaaB subunit	Rhodococcus erythropolis PR4 Gene: RER_55490: Phenylacetate-CoA oxygenase, PaaB subunit	Rhodococcus opacus B4 Gene: ROP_25810: Phenylacetate-CoA oxygenase, PaaB subunit	Rhodococcus sp. RHA1 Gene: RHA1_ro02858: Phenylacetate-CoA oxygenase, PaaB subunit	Phenylacetate-CoA oxygenase, PaaB subunit
paaC	Nocardia farcinica IFM 10152 Gene: nfa21630: Phenylacetate-CoA oxygenase, PaaC subunit	Rhodococcus erythropolis PR4 Gene: RER_55480: Phenylacetate-CoA oxygenase, PaaC subunit	Rhodococcus opacus B4 Gene: ROP_25800: Phenylacetate-CoA oxygenase, PaaC subunit	Rhodococcus sp. RHA1 Gene: RHA1_ro02857: Phenylacetate-CoA oxygenase, PaaC subunit	Phenylacetate-CoA oxygenase, PaaC subunit
paaD	Nocardia farcinica IFM 10152 Gene: nfa21640: Phenylacetate-CoA oxygenase, PaaD subunit	Rhodococcus erythropolis PR4 Gene: RER_55470: Phenylacetate-CoA oxygenase, PaaD subunit	Rhodococcus opacus B4 Gene: ROP_25790: Phenylacetate-CoA oxygenase, PaaD subunit	Rhodococcus sp. RHA1 Gene: RHA1_ro02856: Phenylacetate-CoA oxygenase, PaaD subunit	Phenylacetate-CoA oxygenase, PaaD subunit
paaE	Nocardia farcinica IFM 10152 Gene: nfa21650: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)	Rhodococcus erythropolis PR4 Gene: RER_55460: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)	Rhodococcus opacus B4 Gene: ROP_25780: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)	Rhodococcus sp. RHA1 Gene: RHA1_ro02855: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
paaK	Nocardia farcinica IFM 10152 Gene: nfa21660: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)	Rhodococcus erythropolis PR4 Gene: RER_55450: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)	Rhodococcus opacus B4 Gene: ROP_25770: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)	Rhodococcus sp. RHA1 Gene: RHA1_ro02854: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaQ	* Nocardia farcinica IFM 10152 Site: position = -78 score = 5.75507 sequence = ACTGACCGAACAGTCGGTAATA Gene: nfa20960: Transcriptional regulator, AraC family	Rhodococcus erythropolis PR4	Rhodococcus opacus B4 Gene: ROP_25760: Transcriptional regulator, AraC family	Rhodococcus sp. RHA1 Gene: RHA1_ro02853: Transcriptional regulator, AraC family	Transcriptional regulator, AraC family

CRON 2.
paaZ	* Nocardia farcinica IFM 10152 Site: position = -32 score = 5.32913 sequence = ACCGACCGAATGTTCAGTTGAA Gene: nfa21550: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ	* Rhodococcus erythropolis PR4 Site: position = -32 score = 5.60354 sequence = ACCGACCGAACGTACGGTGAGA Gene: RER_55550: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ	* Rhodococcus opacus B4 Site: position = -127 score = 5.70362 sequence = AATAACCGAATCTTCGGTCGGT Site: position = -32 score = 5.37147 sequence = ACCGACCGAACGTACGGTGAAA Gene: ROP_25870: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ	* Rhodococcus sp. RHA1 Site: position = -128 score = 5.70362 sequence = AATAACCGAATCTTCGGTCGGT Site: position = -32 score = 5.37147 sequence = ACCGACCGAACGTACGGTGAAA Gene: RHA1_ro02864: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
ethD	Nocardia farcinica IFM 10152 Gene: nfa21540: Possible ethyl tert-butyl ether degradation protein EthD	Rhodococcus erythropolis PR4 Gene: RER_55560: Possible ethyl tert-butyl ether degradation protein EthD	Rhodococcus opacus B4 Gene: ROP_25880: Possible ethyl tert-butyl ether degradation protein EthD	Rhodococcus sp. RHA1 Gene: RHA1_ro02865: Possible ethyl tert-butyl ether degradation protein EthD	Possible ethyl tert-butyl ether degradation protein EthD
paaI	Nocardia farcinica IFM 10152 Gene: nfa21530: Phenylacetic acid degradation protein PaaI, thioesterase	Rhodococcus erythropolis PR4 Gene: RER_55570: Phenylacetic acid degradation protein PaaI, thioesterase	Rhodococcus opacus B4 Gene: ROP_25890: Phenylacetic acid degradation protein PaaI, thioesterase	Rhodococcus sp. RHA1 Gene: RHA1_ro02866: Phenylacetic acid degradation protein PaaI, thioesterase	Phenylacetic acid degradation protein PaaI, thioesterase

CRON 3.
paaR	* Nocardia farcinica IFM 10152 Site: position = -81 score = 5.9106 sequence = TATTACCGAACATTCGGTCAGT Gene: nfa21560: Transcriptional regulator of phenylacetic acid degradation, TetR family	* Rhodococcus erythropolis PR4 Site: position = -80 score = 5.98634 sequence = AATAACCGAACATTCGGTCGTT Gene: RER_55540: Transcriptional regulator of phenylacetic acid degradation, TetR family	* Rhodococcus opacus B4 Site: position = -80 score = 4.82171 sequence = CTGAACCGAACCTTCGGTCGGC Gene: ROP_23860: Transcriptional regulator of phenylacetic acid degradation, TetR family	* Rhodococcus sp. RHA1 Site: position = -80 score = 5.21938 sequence = TTCAACCGAACCTTCGGTCGGC Gene: RHA1_ro02633: Transcriptional regulator of phenylacetic acid degradation, TetR family	Transcriptional regulator of phenylacetic acid degradation, TetR family

CRON 4.
paaT	Nocardia farcinica IFM 10152	Rhodococcus erythropolis PR4	* Rhodococcus opacus B4 Site: position = -122 score = 5.71141 sequence = ACCAACCGAACGTACGGTTATA Site: position = -39 score = 5.44463 sequence = CCTGACCGAACAATCGGTCGAG Gene: ROP_17540: Predicted phylacetic acid transporter PaaT	* Rhodococcus sp. RHA1 Site: position = -124 score = 5.71141 sequence = ACCAACCGAACGTACGGTTATA Site: position = -40 score = 5.10434 sequence = CCTGACCGAACAGTCGTTCGCA Gene: RHA1_ro02082: Predicted phylacetic acid transporter PaaT	Predicted phylacetic acid transporter PaaT

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog PaaR - Nocardiaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --