Regulog PaaR - Nocardiaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Phenylacetic acid degradation |
| Effector: | Phenylacetyl-CoA |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Nocardiaceae
- By trascription factor - PaaR
- By TF family - TetR
- By effector - Phenylacetyl-CoA
- By pathway - Phenylacetic acid degradation
| Genome | Genes | Operons |
|---|---|---|
| Nocardia farcinica IFM 10152 | 15 | 4 |
| Rhodococcus erythropolis PR4 | 10 | 3 |
| Rhodococcus opacus B4 | 16 | 4 |
| Rhodococcus sp. RHA1 | 16 | 5 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| paaJ |
*
Nocardia farcinica IFM 10152 Site: position = -49 score = 5.9106 sequence = ACTGACCGAATGTTCGGTAATA Gene: nfa21570: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
|
*
Rhodococcus opacus B4 Site: position = -148 score = 5.37147 sequence = TTTCACCGTACGTTCGGTCGGT Site: position = -53 score = 5.70362 sequence = ACCGACCGAAGATTCGGTTATT Gene: ROP_25860: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
*
Rhodococcus sp. RHA1 Site: position = -149 score = 5.37147 sequence = TTTCACCGTACGTTCGGTCGGT Site: position = -53 score = 5.70362 sequence = ACCGACCGAAGATTCGGTTATT Gene: RHA1_ro02863: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) |
| paaF |
Gene: nfa21580: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: RER_55530: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: ROP_25850: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: RHA1_ro02862: Enoyl-CoA hydratase (EC 4.2.1.17) |
Enoyl-CoA hydratase (EC 4.2.1.17) |
| paaH |
Gene: nfa21590: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
Gene: RER_55520: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
Gene: ROP_25840: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
Gene: RHA1_ro02861: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
| paaG |
Gene: nfa21600: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: RER_55510: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: ROP_25830: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: RHA1_ro02860: Enoyl-CoA hydratase (EC 4.2.1.17) |
Enoyl-CoA hydratase (EC 4.2.1.17) |
| paaA |
Gene: nfa21610: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Rhodococcus erythropolis PR4 Site: position = -35 score = 5.63991 sequence = ACCAACCGATCATTCGGTAATA Gene: RER_55500: Phenylacetate-CoA oxygenase, PaaA subunit |
Gene: ROP_25820: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Rhodococcus sp. RHA1 Site: position = -34 score = 5.63991 sequence = ACCAACCGATCATTCGGTAATA Gene: RHA1_ro02859: Phenylacetate-CoA oxygenase, PaaA subunit |
Phenylacetate-CoA oxygenase, PaaA subunit |
| paaB |
Gene: nfa21620: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: RER_55490: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: ROP_25810: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: RHA1_ro02858: Phenylacetate-CoA oxygenase, PaaB subunit |
Phenylacetate-CoA oxygenase, PaaB subunit |
| paaC |
Gene: nfa21630: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: RER_55480: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: ROP_25800: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: RHA1_ro02857: Phenylacetate-CoA oxygenase, PaaC subunit |
Phenylacetate-CoA oxygenase, PaaC subunit |
| paaD |
Gene: nfa21640: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: RER_55470: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: ROP_25790: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: RHA1_ro02856: Phenylacetate-CoA oxygenase, PaaD subunit |
Phenylacetate-CoA oxygenase, PaaD subunit |
| paaE |
Gene: nfa21650: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: RER_55460: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: ROP_25780: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: RHA1_ro02855: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
| paaK |
Gene: nfa21660: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: RER_55450: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: ROP_25770: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: RHA1_ro02854: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
| paaQ |
*
Nocardia farcinica IFM 10152 Site: position = -78 score = 5.75507 sequence = ACTGACCGAACAGTCGGTAATA Gene: nfa20960: Transcriptional regulator, AraC family |
|
Gene: ROP_25760: Transcriptional regulator, AraC family |
Gene: RHA1_ro02853: Transcriptional regulator, AraC family |
Transcriptional regulator, AraC family |
| CRON 2. | |||||
| paaZ |
*
Nocardia farcinica IFM 10152 Site: position = -32 score = 5.32913 sequence = ACCGACCGAATGTTCAGTTGAA Gene: nfa21550: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
*
Rhodococcus erythropolis PR4 Site: position = -32 score = 5.60354 sequence = ACCGACCGAACGTACGGTGAGA Gene: RER_55550: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
*
Rhodococcus opacus B4 Site: position = -127 score = 5.70362 sequence = AATAACCGAATCTTCGGTCGGT Site: position = -32 score = 5.37147 sequence = ACCGACCGAACGTACGGTGAAA Gene: ROP_25870: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
*
Rhodococcus sp. RHA1 Site: position = -128 score = 5.70362 sequence = AATAACCGAATCTTCGGTCGGT Site: position = -32 score = 5.37147 sequence = ACCGACCGAACGTACGGTGAAA Gene: RHA1_ro02864: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
| ethD |
Gene: nfa21540: Possible ethyl tert-butyl ether degradation protein EthD |
Gene: RER_55560: Possible ethyl tert-butyl ether degradation protein EthD |
Gene: ROP_25880: Possible ethyl tert-butyl ether degradation protein EthD |
Gene: RHA1_ro02865: Possible ethyl tert-butyl ether degradation protein EthD |
Possible ethyl tert-butyl ether degradation protein EthD |
| paaI |
Gene: nfa21530: Phenylacetic acid degradation protein PaaI, thioesterase |
Gene: RER_55570: Phenylacetic acid degradation protein PaaI, thioesterase |
Gene: ROP_25890: Phenylacetic acid degradation protein PaaI, thioesterase |
Gene: RHA1_ro02866: Phenylacetic acid degradation protein PaaI, thioesterase |
Phenylacetic acid degradation protein PaaI, thioesterase |
| CRON 3. | |||||
| paaR |
*
Nocardia farcinica IFM 10152 Site: position = -81 score = 5.9106 sequence = TATTACCGAACATTCGGTCAGT Gene: nfa21560: Transcriptional regulator of phenylacetic acid degradation, TetR family |
*
Rhodococcus erythropolis PR4 Site: position = -80 score = 5.98634 sequence = AATAACCGAACATTCGGTCGTT Gene: RER_55540: Transcriptional regulator of phenylacetic acid degradation, TetR family |
*
Rhodococcus opacus B4 Site: position = -80 score = 4.82171 sequence = CTGAACCGAACCTTCGGTCGGC Gene: ROP_23860: Transcriptional regulator of phenylacetic acid degradation, TetR family |
*
Rhodococcus sp. RHA1 Site: position = -80 score = 5.21938 sequence = TTCAACCGAACCTTCGGTCGGC Gene: RHA1_ro02633: Transcriptional regulator of phenylacetic acid degradation, TetR family |
Transcriptional regulator of phenylacetic acid degradation, TetR family |
| CRON 4. | |||||
| paaT |
|
|
*
Rhodococcus opacus B4 Site: position = -122 score = 5.71141 sequence = ACCAACCGAACGTACGGTTATA Site: position = -39 score = 5.44463 sequence = CCTGACCGAACAATCGGTCGAG Gene: ROP_17540: Predicted phylacetic acid transporter PaaT |
*
Rhodococcus sp. RHA1 Site: position = -124 score = 5.71141 sequence = ACCAACCGAACGTACGGTTATA Site: position = -40 score = 5.10434 sequence = CCTGACCGAACAGTCGTTCGCA Gene: RHA1_ro02082: Predicted phylacetic acid transporter PaaT |
Predicted phylacetic acid transporter PaaT |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |