Regulon of PaaR in Rhodococcus erythropolis PR4

Properties
Regulator type:	Transcription factor
TF locus tag:	RER_55540
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Nocardiaceae
Statistics of regulated genes:
- Genes	10
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Nocardiaceae
By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 5.6 Sequence: ACCAACCGATCATTCGGTAATA Locus tag: RER_55500 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: RER_55490 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: RER_55480 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: RER_55470 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: RER_55460 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: RER_55450 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	RER_55500	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	RER_55490	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	RER_55480	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	RER_55470	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	RER_55460	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	RER_55450	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Position: -32 Score: 5.6 Sequence: ACCGACCGAACGTACGGTGAGA Locus tag: RER_55550 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ Locus tag: RER_55560 Name: ethD Funciton: Possible ethyl tert-butyl ether degradation protein EthD Locus tag: RER_55570 Name: paaI Funciton: Phenylacetic acid degradation protein PaaI, thioesterase
	RER_55550	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	RER_55560	ethD	Possible ethyl tert-butyl ether degradation protein EthD
	RER_55570	paaI	Phenylacetic acid degradation protein PaaI, thioesterase
Position: -80 Score: 6 Sequence: AATAACCGAACATTCGGTCGTT Locus tag: RER_55540 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	RER_55540	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD