Regulon of PaaR in Nocardia farcinica IFM 10152

Properties
Regulator type:	Transcription factor
TF locus tag:	nfa21560
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Nocardiaceae
Statistics of regulated genes:
- Genes	15
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Nocardiaceae
By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -78 Score: 5.8 Sequence: ACTGACCGAACAGTCGGTAATA Locus tag: nfa20960 Name: paaQ Funciton: Transcriptional regulator, AraC family
	nfa20960	paaQ	Transcriptional regulator, AraC family
Position: -49 Score: 5.9 Sequence: ACTGACCGAATGTTCGGTAATA Locus tag: nfa21570 Name: paaJ Funciton: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) Locus tag: nfa21580 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: nfa21590 Name: paaH Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) Locus tag: nfa21600 Name: paaG Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: nfa21610 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: nfa21620 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: nfa21630 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: nfa21640 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: nfa21650 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: nfa21660 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	nfa21570	paaJ	Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
	nfa21580	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	nfa21590	paaH	3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
	nfa21600	paaG	Enoyl-CoA hydratase (EC 4.2.1.17)
	nfa21610	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	nfa21620	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	nfa21630	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	nfa21640	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	nfa21650	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	nfa21660	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Position: -32 Score: 5.3 Sequence: ACCGACCGAATGTTCAGTTGAA Locus tag: nfa21550 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ Locus tag: nfa21540 Name: ethD Funciton: Possible ethyl tert-butyl ether degradation protein EthD Locus tag: nfa21530 Name: paaI Funciton: Phenylacetic acid degradation protein PaaI, thioesterase
	nfa21550	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	nfa21540	ethD	Possible ethyl tert-butyl ether degradation protein EthD
	nfa21530	paaI	Phenylacetic acid degradation protein PaaI, thioesterase
Position: -81 Score: 5.9 Sequence: TATTACCGAACATTCGGTCAGT Locus tag: nfa21560 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	nfa21560	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD