Regulon of PaaR in Rhodococcus sp. RHA1

Properties
Regulator type:	Transcription factor
TF locus tag:	RHA1_ro02633
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Nocardiaceae
Statistics of regulated genes:
- Genes	16
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Nocardiaceae
By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -124 Score: 5.7 Sequence: ACCAACCGAACGTACGGTTATA Position: -40 Score: 5.1 Sequence: CCTGACCGAACAGTCGTTCGCA Locus tag: RHA1_ro02082 Name: paaT Funciton: Predicted phylacetic acid transporter PaaT
	RHA1_ro02082	paaT	Predicted phylacetic acid transporter PaaT
Position: -128 Score: 5.7 Sequence: AATAACCGAATCTTCGGTCGGT Position: -32 Score: 5.4 Sequence: ACCGACCGAACGTACGGTGAAA Locus tag: RHA1_ro02864 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ Locus tag: RHA1_ro02865 Name: ethD Funciton: Possible ethyl tert-butyl ether degradation protein EthD Locus tag: RHA1_ro02866 Name: paaI Funciton: Phenylacetic acid degradation protein PaaI, thioesterase
	RHA1_ro02864	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	RHA1_ro02865	ethD	Possible ethyl tert-butyl ether degradation protein EthD
	RHA1_ro02866	paaI	Phenylacetic acid degradation protein PaaI, thioesterase
Position: -34 Score: 5.6 Sequence: ACCAACCGATCATTCGGTAATA Locus tag: RHA1_ro02859 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: RHA1_ro02858 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: RHA1_ro02857 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: RHA1_ro02856 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: RHA1_ro02855 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: RHA1_ro02854 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) Locus tag: RHA1_ro02853 Name: paaQ Funciton: Transcriptional regulator, AraC family
	RHA1_ro02859	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	RHA1_ro02858	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	RHA1_ro02857	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	RHA1_ro02856	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	RHA1_ro02855	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	RHA1_ro02854	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	RHA1_ro02853	paaQ	Transcriptional regulator, AraC family
Position: -149 Score: 5.4 Sequence: TTTCACCGTACGTTCGGTCGGT Position: -53 Score: 5.7 Sequence: ACCGACCGAAGATTCGGTTATT Locus tag: RHA1_ro02863 Name: paaJ Funciton: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-) Locus tag: RHA1_ro02862 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: RHA1_ro02861 Name: paaH Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) Locus tag: RHA1_ro02860 Name: paaG Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
	RHA1_ro02863	paaJ	Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
	RHA1_ro02862	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	RHA1_ro02861	paaH	3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
	RHA1_ro02860	paaG	Enoyl-CoA hydratase (EC 4.2.1.17)
Position: -80 Score: 5.2 Sequence: TTCAACCGAACCTTCGGTCGGC Locus tag: RHA1_ro02633 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	RHA1_ro02633	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of PaaR in Rhodococcus sp. RHA1

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --