Regulog HrcA - Frankineae/Propionibacterineae/Pseudonocardiaceae

Properties
Regulator type:	Transcription factor
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Phylum:	Actinobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 47 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Frankineae/Propionibacterineae/Pseudonocardiaceae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Statistics of regulated genes
Genome	Genes	Operons
Frankia sp. EAN1pec	9	6
Frankia sp. CcI3	7	4
Nakamurella multipartita DSM 44233	8	5
Acidothermus cellulolyticus 11B	8	5
Nocardioides sp. JS614	7	4
Propionibacterium acnes KPA171202	6	3
Actinosynnema mirum DSM 43827	4	3
Saccharomonospora viridis DSM 43017	4	3
Saccharopolyspora erythraea NRRL 2338	3	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes										Function

CRON 1.
groS	* Frankia sp. EAN1pec Site: position = -105 score = 6.9424 sequence = TTGGCACTCGGCACTTGAGAGTGCCAG Gene: Franean1_6002: Heat shock protein 60 family co-chaperone GroES	* Frankia sp. CcI3 Site: position = -108 score = 6.98317 sequence = TTGGCACTCGGCACGTGAGAGTGCCAG Gene: Francci3_0632: Heat shock protein 60 family co-chaperone GroES	* Nakamurella multipartita DSM 44233 Site: position = -156 score = 6.46639 sequence = CTGGCACTCCCATGGCTAGAGTGCTAG Gene: Namu_1207: Heat shock protein 60 family co-chaperone GroES	* Acidothermus cellulolyticus 11B Site: position = -179 score = 6.38499 sequence = CTGGCACTCTCCTTGACGGAGTGCTAA Site: position = -133 score = 6.54198 sequence = CTGGCACTCTCGACCCGAGGGTGCCAA Gene: Acel_0362: Heat shock protein 60 family co-chaperone GroES	* Nocardioides sp. JS614 Site: position = -168 score = 6.51093 sequence = CTGGCACTCAGTTGGCGAGAGTGCTAG Site: position = -133 score = 6.75924 sequence = TTGGCACTCTCCACCGGAGTGTGCCAG Gene: Noca_3647: Heat shock protein 60 family co-chaperone GroES	* Propionibacterium acnes KPA171202 Site: position = -132 score = 6.48037 sequence = TTGGCACTCTCGTGGTGAGTGTGCCAA Site: position = -179 score = 6.38365 sequence = CTGGCACTCCCGTTGCCTGAGTGCCAA Gene: PPA1773: Heat shock protein 60 family co-chaperone GroES	* Actinosynnema mirum DSM 43827 Site: position = -128 score = 6.70716 sequence = TTGGCACTCGAATGGGTAGAGTGCTAG Gene: Amir_6544: Heat shock protein 60 family co-chaperone GroES	* Saccharomonospora viridis DSM 43017 Site: position = -133 score = 6.58716 sequence = CTAGCACTCAGCTGGCTAGAGTGCTAA Gene: Svir_04660: Heat shock protein 60 family co-chaperone GroES	* Saccharopolyspora erythraea NRRL 2338 Site: position = -131 score = 6.83053 sequence = CTGGCACTCGCGTGGGTAGAGTGCTAG Gene: SACE_6715: Heat shock protein 60 family co-chaperone GroES	Heat shock protein 60 family co-chaperone GroES
groL	Frankia sp. EAN1pec Gene: Franean1_6001: Heat shock protein 60 family chaperone GroEL	Frankia sp. CcI3 Gene: Francci3_0633: Heat shock protein 60 family chaperone GroEL	Nakamurella multipartita DSM 44233 Gene: Namu_1208: Heat shock protein 60 family chaperone GroEL	Acidothermus cellulolyticus 11B Gene: Acel_0363: Heat shock protein 60 family chaperone GroEL	Nocardioides sp. JS614 Gene: Noca_3646: Heat shock protein 60 family chaperone GroEL	Propionibacterium acnes KPA171202 Gene: PPA1772: Heat shock protein 60 family chaperone GroEL	Actinosynnema mirum DSM 43827 Gene: Amir_6543: Heat shock protein 60 family chaperone GroEL	Saccharomonospora viridis DSM 43017 Gene: Svir_04670: Heat shock protein 60 family chaperone GroEL	Saccharopolyspora erythraea NRRL 2338 Gene: SACE_6714: Heat shock protein 60 family chaperone GroEL	Heat shock protein 60 family chaperone GroEL

CRON 2.
groL2	3 Frankia sp. EAN1pec* Site: position = -188 score = 6.61602 sequence = CTTGCACTCACCCATGCCGAGTGCTAA Site: position = -154 score = 6.80049 sequence = TTGGCACTCTCCCCATGGGAGTGCCAA Gene: Franean1_0175: Heat shock protein 60 family chaperone GroEL Site: position = -139 score = 6.86381 sequence = TTAGCACTCGACAGGGTTGAGTGCCAA Gene: Franean1_3854: Heat shock protein 60 family chaperone GroEL Site: position = -140 score = 6.71087 sequence = CTGGCACTCAGCTAGGTCGAGTGCCAA Gene: Franean1_3353: Heat shock protein 60 family chaperone GroEL	2 Frankia sp. CcI3* Site: position = -168 score = 6.66771 sequence = CTGGCACTCTCGCCTAGGGAGTGCCAA Site: position = -202 score = 6.65679 sequence = CTTGCACTCACCCAGGCCGAGTGCTAA Gene: Francci3_4398: Heat shock protein 60 family chaperone GroEL Gene: Francci3_2175: Heat shock protein 60 family chaperone GroEL	* Nakamurella multipartita DSM 44233 Site: position = -192 score = 6.31984 sequence = TTGGCACTCGGAACCAACGAGTGCCAG Site: position = -226 score = 6.84435 sequence = CTTGCACTCTCCGCGGTCGAGTGCTAA Gene: Namu_4827: Heat shock protein 60 family chaperone GroEL	* Acidothermus cellulolyticus 11B Site: position = -179 score = 6.4876 sequence = CTTGCACTCTCGACCCTTGAGTGCTAA Site: position = -144 score = 6.21885 sequence = CTAGCACTCCACATCGGAGAGTGACAA Gene: Acel_0101: Heat shock protein 60 family chaperone GroEL	* Nocardioides sp. JS614 Site: position = -195 score = 6.69179 sequence = CTTGCACTCTCAGGGGTCGAGTGCTAA Site: position = -160 score = 6.7962 sequence = CTGGCACTCTCCCCCGGAGAGTGACAA Gene: Noca_3982: Heat shock protein 60 family chaperone GroEL	* Propionibacterium acnes KPA171202 Site: position = -195 score = 6.46705 sequence = TTGGCACTCGACAAGCGAGAGTGCTAC Site: position = -230 score = 6.48173 sequence = TTTGCACTCGCTGGGTGTGAGTGCTAA Gene: PPA0453: Heat shock protein 60 family chaperone GroEL	* Actinosynnema mirum DSM 43827 Site: position = -178 score = 6.88671 sequence = CTGGCACTCGGCACTGCTGAGTGCCAG Site: position = -213 score = 6.79657 sequence = CTTGCACTCTCGGGTGGCGAGTGCTAA Gene: Amir_0442: Heat shock protein 60 family chaperone GroEL	* Saccharomonospora viridis DSM 43017 Site: position = -168 score = 6.91385 sequence = TTGGCACTCGGCACCGTCGAGTGCTAG Site: position = -203 score = 6.64086 sequence = CTTGCACTCTCACCCTGAGAGTGCTAA Gene: Svir_34390: Heat shock protein 60 family chaperone GroEL	* Saccharopolyspora erythraea NRRL 2338 Site: position = -180 score = 6.76932 sequence = CTGGCACTCAGCAAGGTCGAGTGCCAG Site: position = -215 score = 6.83734 sequence = CTTGCACTCGCCACGCGAGAGTGCTAA Gene: SACE_0527: Heat shock protein 60 family chaperone GroEL	Heat shock protein 60 family chaperone GroEL

CRON 3.
hrcA	* Frankia sp. EAN1pec Site: position = -152 score = 6.92838 sequence = TTGGCACTCACGGCGGCCGAGTGCCAG Gene: Franean1_2109: Heat shock response transcriptional regulator HrcA, HrcA family	* Frankia sp. CcI3 Site: position = -95 score = 6.82404 sequence = TTGGCACTCACTGCGGCCGAGTGCCAA Gene: Francci3_1264: Heat shock response transcriptional regulator HrcA, HrcA family	* Nakamurella multipartita DSM 44233 Site: position = -57 score = 6.1037 sequence = TTGGCAGCCGGAGCGGGCGAGTGCCAA Gene: Namu_1571: Heat shock response transcriptional regulator HrcA, HrcA family	* Acidothermus cellulolyticus 11B Site: position = -78 score = 6.6421 sequence = CTGGCACTCGACAACCCTGAGTGCCAA Gene: Acel_0783: Heat shock response transcriptional regulator HrcA, HrcA family	* Nocardioides sp. JS614 Site: position = -73 score = 6.63343 sequence = TTGGCACTCAGGACTTTCGAGTGCCAG Gene: Noca_1903: Heat shock response transcriptional regulator HrcA, HrcA family	* Propionibacterium acnes KPA171202 Site: position = -67 score = 6.66393 sequence = GTGGCACTCGGCACCCGAGAGTGCCAA Gene: PPA0915: Heat shock response transcriptional regulator HrcA, HrcA family	Actinosynnema mirum DSM 43827 Gene: Amir_1241: Heat shock response transcriptional regulator HrcA, HrcA family	Saccharomonospora viridis DSM 43017 Gene: Svir_13540: Heat shock response transcriptional regulator HrcA, HrcA family	Saccharopolyspora erythraea NRRL 2338 Gene: SACE_1479: Heat shock response transcriptional regulator HrcA, HrcA family	Heat shock response transcriptional regulator HrcA, HrcA family
dnaJ	Frankia sp. EAN1pec Gene: Franean1_2110: Chaperone protein DnaJ	Frankia sp. CcI3 Gene: Francci3_1265: Chaperone protein DnaJ	Nakamurella multipartita DSM 44233 Gene: Namu_1572: Chaperone protein DnaJ	Acidothermus cellulolyticus 11B Gene: Acel_0784: Chaperone protein DnaJ	Nocardioides sp. JS614 Gene: Noca_1904: Chaperone protein DnaJ	Propionibacterium acnes KPA171202 Gene: PPA0916: Chaperone protein DnaJ	Actinosynnema mirum DSM 43827 Gene: Amir_1242: Chaperone protein DnaJ	Saccharomonospora viridis DSM 43017 Gene: Svir_13550: Chaperone protein DnaJ	Saccharopolyspora erythraea NRRL 2338 Gene: SACE_1480: Chaperone protein DnaJ	Chaperone protein DnaJ
rsmE	Frankia sp. EAN1pec Gene: Franean1_2111: 16S ribosomal RNA methyltransferase	Frankia sp. CcI3 Gene: Francci3_1266: 16S ribosomal RNA methyltransferase	Nakamurella multipartita DSM 44233 Gene: Namu_1573: 16S ribosomal RNA methyltransferase	Acidothermus cellulolyticus 11B Gene: Acel_0785: 16S ribosomal RNA methyltransferase	Nocardioides sp. JS614 Gene: Noca_1905: 16S ribosomal RNA methyltransferase	Propionibacterium acnes KPA171202 Gene: PPA0917: 16S ribosomal RNA methyltransferase	Actinosynnema mirum DSM 43827 Gene: Amir_1243: 16S ribosomal RNA methyltransferase	Saccharomonospora viridis DSM 43017 Gene: Svir_13560: 16S ribosomal RNA methyltransferase	Saccharopolyspora erythraea NRRL 2338 Gene: SACE_1481: 16S ribosomal RNA methyltransferase	16S ribosomal RNA methyltransferase

CRON 4.
COG2331	* Frankia sp. EAN1pec Site: position = -42 score = 5.56926 sequence = TTGGCAGTCCTTACCACCGAGTGCCAA Gene: Franean1_0686: Conserved hypothetical protein	* Frankia sp. CcI3 Site: position = -42 score = 6.52678 sequence = TTGGCAGTCTCCACGTCAGAGTGCCAA Gene: Francci3_4042: Conserved hypothetical protein	* Nakamurella multipartita DSM 44233 Site: position = -61 score = 6.43399 sequence = CTGGCACTGGGCACTGTCGAGTGCCAA Gene: Namu_4645: Conserved hypothetical protein	* Acidothermus cellulolyticus 11B Site: position = -37 score = 5.91134 sequence = TTAGCAATCGAAGCTACCGAGTGCTAA Gene: Acel_0161: Conserved hypothetical protein	* Nocardioides sp. JS614 Site: position = -76 score = 6.74832 sequence = TTGGCACTCGTCAGGGCCGAGTGCCAG Gene: Noca_0787: Conserved hypothetical protein	Propionibacterium acnes KPA171202 Gene: PPA2407: Conserved hypothetical protein	* Actinosynnema mirum DSM 43827 Site: position = -50 score = 6.38508 sequence = TTGGCACTCGTGACGTGGGAGTGCCAA Gene: Amir_0626: Conserved hypothetical protein	* Saccharomonospora viridis DSM 43017 Site: position = -72 score = 6.57679 sequence = TTAGCACTCTCGGCAATCGAGTGCCAG Gene: Svir_32690: Conserved hypothetical protein	Saccharopolyspora erythraea NRRL 2338	Conserved hypothetical protein

CRON 5.
hsp18	Frankia sp. EAN1pec	Frankia sp. CcI3	* Nakamurella multipartita DSM 44233 Site: position = -98 score = 6.77087 sequence = TTGGCACTCTCGGTCGTCGAGTGCTAA Gene: Namu_0179: Small heat shock protein 18	2 Acidothermus cellulolyticus 11B* Gene: Acel_0160: Small heat shock protein 18 Site: position = -54 score = 6.59921 sequence = CTAGCACTCGACAGCACCGAGTGCTAA Gene: Acel_0609: Small heat shock protein 18	Nocardioides sp. JS614	Propionibacterium acnes KPA171202 Gene: PPA0737: Small heat shock protein 18	Actinosynnema mirum DSM 43827	Saccharomonospora viridis DSM 43017	Saccharopolyspora erythraea NRRL 2338 Gene: SACE_3659: Small heat shock protein 18	Small heat shock protein 18

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog HrcA - Frankineae/Propionibacterineae/Pseudonocardiaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --