Regulon of HrcA in Frankia sp. EAN1pec

Properties
Regulator type:	Transcription factor
TF locus tag:	Franean1_2109
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Frankineae/Propionibacterineae/Pseudonocardiaceae
Statistics of regulated genes:
- Genes	9
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 47 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Frankineae/Propionibacterineae/Pseudonocardiaceae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -140 Score: 6.7 Sequence: CTGGCACTCAGCTAGGTCGAGTGCCAA Locus tag: Franean1_3353 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL
	Franean1_3353	groL2	Heat shock protein 60 family chaperone GroEL
Position: -139 Score: 6.9 Sequence: TTAGCACTCGACAGGGTTGAGTGCCAA Locus tag: Franean1_3854 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL
	Franean1_3854	groL2	Heat shock protein 60 family chaperone GroEL
Position: -188 Score: 6.6 Sequence: CTTGCACTCACCCATGCCGAGTGCTAA Position: -154 Score: 6.8 Sequence: TTGGCACTCTCCCCATGGGAGTGCCAA Locus tag: Franean1_0175 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL
	Franean1_0175	groL2	Heat shock protein 60 family chaperone GroEL
Position: -152 Score: 6.9 Sequence: TTGGCACTCACGGCGGCCGAGTGCCAG Locus tag: Franean1_2109 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: Franean1_2110 Name: dnaJ Funciton: Chaperone protein DnaJ Locus tag: Franean1_2111 Name: rsmE Funciton: 16S ribosomal RNA methyltransferase
	Franean1_2109	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	Franean1_2110	dnaJ	Chaperone protein DnaJ
	Franean1_2111	rsmE	16S ribosomal RNA methyltransferase
Position: -42 Score: 5.6 Sequence: TTGGCAGTCCTTACCACCGAGTGCCAA Locus tag: Franean1_0686 Name: COG2331 Funciton: Conserved hypothetical protein
	Franean1_0686	COG2331	Conserved hypothetical protein
Position: -105 Score: 6.9 Sequence: TTGGCACTCGGCACTTGAGAGTGCCAG Locus tag: Franean1_6002 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Franean1_6001 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	Franean1_6002	groS	Heat shock protein 60 family co-chaperone GroES
	Franean1_6001	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD