Regulon of HrcA in Actinosynnema mirum DSM 43827

Properties
Regulator type:	Transcription factor
TF locus tag:	Amir_1241
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Frankineae/Propionibacterineae/Pseudonocardiaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 47 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Frankineae/Propionibacterineae/Pseudonocardiaceae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -213 Score: 6.8 Sequence: CTTGCACTCTCGGGTGGCGAGTGCTAA Position: -178 Score: 6.9 Sequence: CTGGCACTCGGCACTGCTGAGTGCCAG Locus tag: Amir_0442 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL
	Amir_0442	groL2	Heat shock protein 60 family chaperone GroEL
Position: -50 Score: 6.4 Sequence: TTGGCACTCGTGACGTGGGAGTGCCAA Locus tag: Amir_0626 Name: COG2331 Funciton: Conserved hypothetical protein
	Amir_0626	COG2331	Conserved hypothetical protein
Position: -128 Score: 6.7 Sequence: TTGGCACTCGAATGGGTAGAGTGCTAG Locus tag: Amir_6544 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Amir_6543 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	Amir_6544	groS	Heat shock protein 60 family co-chaperone GroES
	Amir_6543	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD