Regulon of HrcA in Frankia sp. CcI3

Properties
Regulator type:	Transcription factor
TF locus tag:	Francci3_1264
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Frankineae/Propionibacterineae/Pseudonocardiaceae
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 47 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Frankineae/Propionibacterineae/Pseudonocardiaceae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -108 Score: 7 Sequence: TTGGCACTCGGCACGTGAGAGTGCCAG Locus tag: Francci3_0632 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Francci3_0633 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	Francci3_0632	groS	Heat shock protein 60 family co-chaperone GroES
	Francci3_0633	groL	Heat shock protein 60 family chaperone GroEL
Position: -95 Score: 6.8 Sequence: TTGGCACTCACTGCGGCCGAGTGCCAA Locus tag: Francci3_1264 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: Francci3_1265 Name: dnaJ Funciton: Chaperone protein DnaJ Locus tag: Francci3_1266 Name: rsmE Funciton: 16S ribosomal RNA methyltransferase
	Francci3_1264	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	Francci3_1265	dnaJ	Chaperone protein DnaJ
	Francci3_1266	rsmE	16S ribosomal RNA methyltransferase
Position: -42 Score: 6.5 Sequence: TTGGCAGTCTCCACGTCAGAGTGCCAA Locus tag: Francci3_4042 Name: COG2331 Funciton: Conserved hypothetical protein
	Francci3_4042	COG2331	Conserved hypothetical protein
Position: -202 Score: 6.7 Sequence: CTTGCACTCACCCAGGCCGAGTGCTAA Position: -168 Score: 6.7 Sequence: CTGGCACTCTCGCCTAGGGAGTGCCAA Locus tag: Francci3_4398 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL
	Francci3_4398	groL2	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD