Regulon of HrcA in Acidothermus cellulolyticus 11B

Properties
Regulator type:	Transcription factor
TF locus tag:	Acel_0783
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Frankineae/Propionibacterineae/Pseudonocardiaceae
Statistics of regulated genes:
- Genes	8
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 47 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Frankineae/Propionibacterineae/Pseudonocardiaceae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -179 Score: 6.4 Sequence: CTGGCACTCTCCTTGACGGAGTGCTAA Position: -133 Score: 6.5 Sequence: CTGGCACTCTCGACCCGAGGGTGCCAA Locus tag: Acel_0362 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Acel_0363 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	Acel_0362	groS	Heat shock protein 60 family co-chaperone GroES
	Acel_0363	groL	Heat shock protein 60 family chaperone GroEL
Position: -78 Score: 6.6 Sequence: CTGGCACTCGACAACCCTGAGTGCCAA Locus tag: Acel_0783 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: Acel_0784 Name: dnaJ Funciton: Chaperone protein DnaJ Locus tag: Acel_0785 Name: rsmE Funciton: 16S ribosomal RNA methyltransferase
	Acel_0783	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	Acel_0784	dnaJ	Chaperone protein DnaJ
	Acel_0785	rsmE	16S ribosomal RNA methyltransferase
Position: -54 Score: 6.6 Sequence: CTAGCACTCGACAGCACCGAGTGCTAA Locus tag: Acel_0609 Name: hsp18 Funciton: Small heat shock protein 18
	Acel_0609	hsp18	Small heat shock protein 18
Position: -179 Score: 6.5 Sequence: CTTGCACTCTCGACCCTTGAGTGCTAA Position: -144 Score: 6.2 Sequence: CTAGCACTCCACATCGGAGAGTGACAA Locus tag: Acel_0101 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL
	Acel_0101	groL2	Heat shock protein 60 family chaperone GroEL
Position: -37 Score: 5.9 Sequence: TTAGCAATCGAAGCTACCGAGTGCTAA Locus tag: Acel_0161 Name: COG2331 Funciton: Conserved hypothetical protein
	Acel_0161	COG2331	Conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD