Regulog CelR - Streptomycetaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	Cellobiose
Phylum:	Actinobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 49 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By TF family - LacI
By effector - Cellobiose
By pathway - Cellobiose utilization

Statistics of regulated genes
Genome	Genes	Operons
Streptomyces avermitilis MA-4680	14	10
Streptomyces coelicolor A3(2)	15	12
Streptomyces griseus subsp. griseus NBRC 13350	11	6
Streptomyces scabiei 87.22	14	11

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
cel1	Streptomyces avermitilis MA-4680	* Streptomyces coelicolor A3(2) Site: position = -54 score = 5.99719 sequence = ATTTGGGAGCGCTCCCATTC Gene: SCO0765: Secreted endoglucanase	Streptomyces griseus subsp. griseus NBRC 13350	* Streptomyces scabiei 87.22 Site: position = -93 score = 5.85688 sequence = AATTGGGAGCGCTCCCACTT Gene: SCAB_8871: Secreted endoglucanase	Secreted endoglucanase

CRON 2.
cbhB	* Streptomyces avermitilis MA-4680 Site: position = -75 score = 6.27626 sequence = ATATGGGAGCGCTCCCACTG Site: position = -218 score = 5.14929 sequence = TGATGGAATCGCTCCCACTG Gene: SAV_1855: 1,4-beta-cellobiohydrolase B (EC 3.2.1.91)	* Streptomyces coelicolor A3(2) Site: position = -79 score = 6.51351 sequence = CTATGGGAGCGCTCCCACTG Site: position = -221 score = 5.14929 sequence = TGATGGAACCGCTCCCACTG Gene: SCO6546: 1,4-beta-cellobiohydrolase B (EC 3.2.1.91)	Streptomyces griseus subsp. griseus NBRC 13350	2 Streptomyces scabiei 87.22* Site: position = -108 score = 6.48089 sequence = TCATGGGAGCGCTCCCACTG Site: position = -251 score = 4.71983 sequence = GTCGGGAACCGCTCCCACTG Gene: SCAB_90091: 1,4-beta-cellobiohydrolase B (EC 3.2.1.91) Site: position = -133 score = 6.27626 sequence = ATATGGGAGCGCTCCCACTG Site: position = -286 score = 5.26179 sequence = TGGTGGAACCGCTCCCACTG Gene: SCAB_17011: 1,4-beta-cellobiohydrolase B (EC 3.2.1.91)	1,4-beta-cellobiohydrolase B (EC 3.2.1.91)
celA3	Streptomyces avermitilis MA-4680 Gene: SAV_1856: Predicted endo-1,4-beta-glucanase	Streptomyces coelicolor A3(2) Gene: SCO6545: Predicted endo-1,4-beta-glucanase	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22 Gene: SCAB_17021: Predicted endo-1,4-beta-glucanase	Predicted endo-1,4-beta-glucanase

CRON 3.
celR	* Streptomyces avermitilis MA-4680 Site: position = -284 score = 6.69021 sequence = CCGTGGGAGCGCTCCCACAA Gene: SAV_5257: Cellobiose utilization transcriptional regulator CelR, LacI family	2 Streptomyces coelicolor A3(2)* Site: position = -238 score = 6.64156 sequence = GTGTGGGAGCGCTCCCACAA Gene: SCO2794: Cellobiose utilization transcriptional regulator CelR, LacI family Gene: SCO7554: Cellobiose utilization transcriptional regulator CelR, LacI family	* Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -109 score = 6.19777 sequence = TCTTGGGAGCGCTCCCAATA Gene: SGR_4739: Cellobiose utilization transcriptional regulator CelR, LacI family	2 Streptomyces scabiei 87.22 Gene: SCAB_57761: Cellobiose utilization transcriptional regulator CelR, LacI family Gene: SCAB_2431: Cellobiose utilization transcriptional regulator CelR, LacI family	Cellobiose utilization transcriptional regulator CelR, LacI family

CRON 4.
SCO7559	* Streptomyces avermitilis MA-4680 Site: position = -69 score = 5.37518 sequence = CTCTGAGAGCGCTCTCAATT Gene: SAV_1053: Putative sugar hydrolase	* Streptomyces coelicolor A3(2) Site: position = -62 score = 5.41538 sequence = CGCTGAGAGCGCTCTCAGAA Gene: SCO7559: Putative sugar hydrolase	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22	Putative sugar hydrolase

CRON 5.
SCO0716	* Streptomyces avermitilis MA-4680 Site: position = -102 score = 5.11229 sequence = TTCAGAGAGCGCTCTCAGAC Gene: SAV_967: Putative glycosyl hydrolase	* Streptomyces coelicolor A3(2) Site: position = -53 score = 5.67928 sequence = GCGTGAGAGCGCTCTCAGGC Gene: SCO0716: Putative glycosyl hydrolase	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22	Putative glycosyl hydrolase

CRON 6.
gunA2	Streptomyces avermitilis MA-4680	* Streptomyces coelicolor A3(2) Site: position = -87 score = 6.02346 sequence = AAGTGGGAGCGCTCCCATCA Site: position = -61 score = 5.33597 sequence = AGTTGGGAGCGCTCCCGCAC Gene: SCO1187: Endoglucanase A (EC 3.2.1.4)	Streptomyces griseus subsp. griseus NBRC 13350	* Streptomyces scabiei 87.22 Site: position = -85 score = 6.07845 sequence = AAATGGGAGCGCTCCCAAAG Gene: SCAB_5981: Endoglucanase A (EC 3.2.1.4)	Endoglucanase A (EC 3.2.1.4)

CRON 7.
celA1	* Streptomyces avermitilis MA-4680 Site: position = -220 score = 6.29459 sequence = TTTTGGGAGCGCTCCCAAGA Site: position = -75 score = 5.9422 sequence = GAATGGGAGCGCTCCCACCT Site: position = -51 score = 5.46072 sequence = TGATGGGAGCGCTCCCGAAC Gene: SAV_555: Endoglucanase (EC 3.2.1.4)	Streptomyces coelicolor A3(2)	Streptomyces griseus subsp. griseus NBRC 13350	* Streptomyces scabiei 87.22 Site: position = -63 score = 6.11651 sequence = TCTTGGGAGCGCTCCCAATC Gene: SCAB_90081: Endoglucanase (EC 3.2.1.4)	Endoglucanase (EC 3.2.1.4)

CRON 8.
celA2	Streptomyces avermitilis MA-4680	Streptomyces coelicolor A3(2)	* Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -33 score = 6.34693 sequence = GATTGGGAGCGCTCCCACAG Gene: SGR_2445: Endoglucanase (EC 3.2.1.4)	* Streptomyces scabiei 87.22 Site: position = -131 score = 5.13041 sequence = TACTGGAAGCGCTTCCAATG Site: position = -116 score = 6.02346 sequence = CAATGGGAGCGCTCCCACCT Gene: SCAB_16431: Endoglucanase (EC 3.2.1.4)	Endoglucanase (EC 3.2.1.4)

CRON 9.
lamA1	* Streptomyces avermitilis MA-4680 Site: position = -60 score = 5.68507 sequence = TCTTGAGAGCGCTCTCAAGG Gene: SAV_1764: Predicted endo-1,3-beta-glucanase	* Streptomyces coelicolor A3(2) Site: position = -85 score = 5.66818 sequence = CTCTGAGAGCGCTCTCAGAA Gene: SCO6665: Predicted endo-1,3-beta-glucanase	Streptomyces griseus subsp. griseus NBRC 13350	* Streptomyces scabiei 87.22 Site: position = -140 score = 5.67662 sequence = TTTTGAGAGCGCTCTCAGGA Gene: SCAB_15711: Predicted endo-1,3-beta-glucanase	Predicted endo-1,3-beta-glucanase

CRON 10.
SCO7637	Streptomyces avermitilis MA-4680	* Streptomyces coelicolor A3(2) Site: position = 29 score = 6.15972 sequence = CTTTGGGAGCGCTCCCATCG Gene: SCO7637: Secreted endoglucanase	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22	Secreted endoglucanase

CRON 11.
SCO0643	Streptomyces avermitilis MA-4680	* Streptomyces coelicolor A3(2) Site: position = -74 score = 6.26602 sequence = CCTTGGGAGCGCTCCCATGC Gene: SCO0643: Putative secreted cellulose-binding protein	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22	Putative secreted cellulose-binding protein

CRON 12.
celA2	* Streptomyces avermitilis MA-4680 Site: position = -209 score = 6.27626 sequence = CAGTGGGAGCGCTCCCATAT Site: position = -66 score = 5.14929 sequence = CAGTGGGAGCGATTCCATCA Gene: SAV_1854: Predicted endo-1,4-beta-glucanase	Streptomyces coelicolor A3(2)	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22	Predicted endo-1,4-beta-glucanase
cbhA	Streptomyces avermitilis MA-4680 Gene: SAV_1853: 1,4-beta-cellobiohydrolase A (EC 3.2.1.91)	* Streptomyces coelicolor A3(2) Site: position = -318 score = 5.14929 sequence = CAGTGGGAGCGGTTCCATCA Gene: SCO6548: 1,4-beta-cellobiohydrolase A (EC 3.2.1.91)	Streptomyces griseus subsp. griseus NBRC 13350	* Streptomyces scabiei 87.22 Site: position = -314 score = 6.27626 sequence = CAGTGGGAGCGCTCCCATAT Site: position = -161 score = 5.26179 sequence = CAGTGGGAGCGGTTCCACCA Gene: SCAB_17001: 1,4-beta-cellobiohydrolase A (EC 3.2.1.91)	1,4-beta-cellobiohydrolase A (EC 3.2.1.91)

CRON 13.
cebE	* Streptomyces avermitilis MA-4680 Site: position = -134 score = 6.69021 sequence = TTGTGGGAGCGCTCCCACGG Gene: SAV_5256: Cellobiose specific ABC transporter, substrate-binding protein	2 Streptomyces coelicolor A3(2)* Site: position = -147 score = 6.64156 sequence = TTGTGGGAGCGCTCCCACAC Gene: SCO2795: Cellobiose specific ABC transporter, substrate-binding protein Gene: SCO7555: Cellobiose specific ABC transporter, substrate-binding protein	2 Streptomyces griseus subsp. griseus NBRC 13350* Site: position = -55 score = 5.48044 sequence = ATTTGAGAGCGCTCTCAAGG Gene: SGR_3212: Cellobiose specific ABC transporter, substrate-binding protein Site: position = -124 score = 6.31836 sequence = GCATGGGAGCGCTCCCACTC Gene: SGR_4735: Cellobiose specific ABC transporter, substrate-binding protein	2 Streptomyces scabiei 87.22* Gene: SCAB_2421: Cellobiose specific ABC transporter, substrate-binding protein Site: position = -133 score = 6.69021 sequence = TCGTGGGAGCGCTCCCACAG Gene: SCAB_57751: Cellobiose specific ABC transporter, substrate-binding protein	Cellobiose specific ABC transporter, substrate-binding protein
cebF	Streptomyces avermitilis MA-4680 Gene: SAV_5255: Cellobiose specific ABC transporter, permease protein 1	2 Streptomyces coelicolor A3(2) Gene: SCO2796: Cellobiose specific ABC transporter, permease protein 1 Gene: SCO7556: Cellobiose specific ABC transporter, permease protein 1	2 Streptomyces griseus subsp. griseus NBRC 13350 Gene: SGR_3213: Cellobiose specific ABC transporter, permease protein 1 Gene: SGR_4736: Cellobiose specific ABC transporter, permease protein 1	2 Streptomyces scabiei 87.22 Gene: SCAB_2411: Cellobiose specific ABC transporter, permease protein 1 Gene: SCAB_57741: Cellobiose specific ABC transporter, permease protein 1	Cellobiose specific ABC transporter, permease protein 1
cebG	Streptomyces avermitilis MA-4680 Gene: SAV_5254: Cellobiose specific ABC transporter, permease protein 2	2 Streptomyces coelicolor A3(2) Gene: SCO2797: Cellobiose specific ABC transporter, permease protein 2 Gene: SCO7557: Cellobiose specific ABC transporter, permease protein 2	2 Streptomyces griseus subsp. griseus NBRC 13350 Gene: SGR_3214: Cellobiose specific ABC transporter, permease protein 2 Gene: SGR_4737: Cellobiose specific ABC transporter, permease protein 2	2 Streptomyces scabiei 87.22 Gene: SCAB_2401: Cellobiose specific ABC transporter, permease protein 2 Gene: SCAB_57731: Cellobiose specific ABC transporter, permease protein 2	Cellobiose specific ABC transporter, permease protein 2
bglC2	* Streptomyces avermitilis MA-4680 Site: position = -88 score = 5.6501 sequence = CGATGGGAGCGCTTCCATGC Gene: SAV_5253: Beta-glucosidase (EC 3.2.1.21)	2 Streptomyces coelicolor A3(2)* Site: position = -16 score = 5.9029 sequence = CTATGGGAGCGCTTCCATGC Gene: SCO2798: Beta-glucosidase (EC 3.2.1.21) Gene: SCO7558: Beta-glucosidase (EC 3.2.1.21)	2 Streptomyces griseus subsp. griseus NBRC 13350* Site: position = -18 score = 5.73947 sequence = CCCAGGGAGCGCTCCCACAT Gene: SGR_4738: Beta-glucosidase (EC 3.2.1.21) Gene: SGR_3215: Beta-glucosidase (EC 3.2.1.21)	2 Streptomyces scabiei 87.22* Gene: SCAB_2391: Beta-glucosidase (EC 3.2.1.21) Site: position = -16 score = 5.80608 sequence = CAATGGGAGCGCTTCCATGC Gene: SCAB_57721: Beta-glucosidase (EC 3.2.1.21)	Beta-glucosidase (EC 3.2.1.21)

CRON 14.
gunA	* Streptomyces avermitilis MA-4680 Site: position = 3 score = 5.88303 sequence = AGGTGGGAGCGCTCCCATAT Gene: SAV_2254: Endoglucanase A (EC 3.2.1.4)	Streptomyces coelicolor A3(2) Gene: SCO1188: Endoglucanase A (EC 3.2.1.4)	* Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -334 score = 6.16544 sequence = GTGTGGGAGCGCTCCCAGAT Gene: SGR_199: Endoglucanase A (EC 3.2.1.4)	* Streptomyces scabiei 87.22 Site: position = -180 score = 6.0064 sequence = GGGTGGGAGCGCTCCCATGT Gene: SCAB_21081: Endoglucanase A (EC 3.2.1.4)	Endoglucanase A (EC 3.2.1.4)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog CelR - Streptomycetaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --