Regulog CelR - Streptomycetaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Cellobiose utilization |
| Effector: | Cellobiose |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptomycetaceae
- By TF family - LacI
- By effector - Cellobiose
- By pathway - Cellobiose utilization
| Genome | Genes | Operons |
|---|---|---|
| Streptomyces avermitilis MA-4680 | 14 | 10 |
| Streptomyces coelicolor A3(2) | 15 | 12 |
| Streptomyces griseus subsp. griseus NBRC 13350 | 11 | 6 |
| Streptomyces scabiei 87.22 | 14 | 11 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| cel1 |
|
*
Streptomyces coelicolor A3(2) Site: position = -54 score = 5.99719 sequence = ATTTGGGAGCGCTCCCATTC Gene: SCO0765: Secreted endoglucanase |
|
*
Streptomyces scabiei 87.22 Site: position = -93 score = 5.85688 sequence = AATTGGGAGCGCTCCCACTT Gene: SCAB_8871: Secreted endoglucanase |
Secreted endoglucanase |
| CRON 2. | |||||
| cbhB |
*
Streptomyces avermitilis MA-4680 Site: position = -75 score = 6.27626 sequence = ATATGGGAGCGCTCCCACTG Site: position = -218 score = 5.14929 sequence = TGATGGAATCGCTCCCACTG Gene: SAV_1855: 1,4-beta-cellobiohydrolase B (EC 3.2.1.91) |
*
Streptomyces coelicolor A3(2) Site: position = -79 score = 6.51351 sequence = CTATGGGAGCGCTCCCACTG Site: position = -221 score = 5.14929 sequence = TGATGGAACCGCTCCCACTG Gene: SCO6546: 1,4-beta-cellobiohydrolase B (EC 3.2.1.91) |
|
*2
Streptomyces scabiei 87.22 Site: position = -108 score = 6.48089 sequence = TCATGGGAGCGCTCCCACTG Site: position = -251 score = 4.71983 sequence = GTCGGGAACCGCTCCCACTG Gene: SCAB_90091: 1,4-beta-cellobiohydrolase B (EC 3.2.1.91) Site: position = -133 score = 6.27626 sequence = ATATGGGAGCGCTCCCACTG Site: position = -286 score = 5.26179 sequence = TGGTGGAACCGCTCCCACTG Gene: SCAB_17011: 1,4-beta-cellobiohydrolase B (EC 3.2.1.91) |
1,4-beta-cellobiohydrolase B (EC 3.2.1.91) |
| celA3 |
Gene: SAV_1856: Predicted endo-1,4-beta-glucanase |
Gene: SCO6545: Predicted endo-1,4-beta-glucanase |
|
Gene: SCAB_17021: Predicted endo-1,4-beta-glucanase |
Predicted endo-1,4-beta-glucanase |
| CRON 3. | |||||
| celR |
*
Streptomyces avermitilis MA-4680 Site: position = -284 score = 6.69021 sequence = CCGTGGGAGCGCTCCCACAA Gene: SAV_5257: Cellobiose utilization transcriptional regulator CelR, LacI family |
*2
Streptomyces coelicolor A3(2) Site: position = -238 score = 6.64156 sequence = GTGTGGGAGCGCTCCCACAA Gene: SCO2794: Cellobiose utilization transcriptional regulator CelR, LacI family Gene: SCO7554: Cellobiose utilization transcriptional regulator CelR, LacI family |
*
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -109 score = 6.19777 sequence = TCTTGGGAGCGCTCCCAATA Gene: SGR_4739: Cellobiose utilization transcriptional regulator CelR, LacI family |
2
Streptomyces scabiei 87.22 Gene: SCAB_57761: Cellobiose utilization transcriptional regulator CelR, LacI family Gene: SCAB_2431: Cellobiose utilization transcriptional regulator CelR, LacI family |
Cellobiose utilization transcriptional regulator CelR, LacI family |
| CRON 4. | |||||
| SCO7559 |
*
Streptomyces avermitilis MA-4680 Site: position = -69 score = 5.37518 sequence = CTCTGAGAGCGCTCTCAATT Gene: SAV_1053: Putative sugar hydrolase |
*
Streptomyces coelicolor A3(2) Site: position = -62 score = 5.41538 sequence = CGCTGAGAGCGCTCTCAGAA Gene: SCO7559: Putative sugar hydrolase |
|
|
Putative sugar hydrolase |
| CRON 5. | |||||
| SCO0716 |
*
Streptomyces avermitilis MA-4680 Site: position = -102 score = 5.11229 sequence = TTCAGAGAGCGCTCTCAGAC Gene: SAV_967: Putative glycosyl hydrolase |
*
Streptomyces coelicolor A3(2) Site: position = -53 score = 5.67928 sequence = GCGTGAGAGCGCTCTCAGGC Gene: SCO0716: Putative glycosyl hydrolase |
|
|
Putative glycosyl hydrolase |
| CRON 6. | |||||
| gunA2 |
|
*
Streptomyces coelicolor A3(2) Site: position = -87 score = 6.02346 sequence = AAGTGGGAGCGCTCCCATCA Site: position = -61 score = 5.33597 sequence = AGTTGGGAGCGCTCCCGCAC Gene: SCO1187: Endoglucanase A (EC 3.2.1.4) |
|
*
Streptomyces scabiei 87.22 Site: position = -85 score = 6.07845 sequence = AAATGGGAGCGCTCCCAAAG Gene: SCAB_5981: Endoglucanase A (EC 3.2.1.4) |
Endoglucanase A (EC 3.2.1.4) |
| CRON 7. | |||||
| celA1 |
*
Streptomyces avermitilis MA-4680 Site: position = -220 score = 6.29459 sequence = TTTTGGGAGCGCTCCCAAGA Site: position = -75 score = 5.9422 sequence = GAATGGGAGCGCTCCCACCT Site: position = -51 score = 5.46072 sequence = TGATGGGAGCGCTCCCGAAC Gene: SAV_555: Endoglucanase (EC 3.2.1.4) |
|
|
*
Streptomyces scabiei 87.22 Site: position = -63 score = 6.11651 sequence = TCTTGGGAGCGCTCCCAATC Gene: SCAB_90081: Endoglucanase (EC 3.2.1.4) |
Endoglucanase (EC 3.2.1.4) |
| CRON 8. | |||||
| celA2 |
|
|
*
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -33 score = 6.34693 sequence = GATTGGGAGCGCTCCCACAG Gene: SGR_2445: Endoglucanase (EC 3.2.1.4) |
*
Streptomyces scabiei 87.22 Site: position = -131 score = 5.13041 sequence = TACTGGAAGCGCTTCCAATG Site: position = -116 score = 6.02346 sequence = CAATGGGAGCGCTCCCACCT Gene: SCAB_16431: Endoglucanase (EC 3.2.1.4) |
Endoglucanase (EC 3.2.1.4) |
| CRON 9. | |||||
| lamA1 |
*
Streptomyces avermitilis MA-4680 Site: position = -60 score = 5.68507 sequence = TCTTGAGAGCGCTCTCAAGG Gene: SAV_1764: Predicted endo-1,3-beta-glucanase |
*
Streptomyces coelicolor A3(2) Site: position = -85 score = 5.66818 sequence = CTCTGAGAGCGCTCTCAGAA Gene: SCO6665: Predicted endo-1,3-beta-glucanase |
|
*
Streptomyces scabiei 87.22 Site: position = -140 score = 5.67662 sequence = TTTTGAGAGCGCTCTCAGGA Gene: SCAB_15711: Predicted endo-1,3-beta-glucanase |
Predicted endo-1,3-beta-glucanase |
| CRON 10. | |||||
| SCO7637 |
|
*
Streptomyces coelicolor A3(2) Site: position = 29 score = 6.15972 sequence = CTTTGGGAGCGCTCCCATCG Gene: SCO7637: Secreted endoglucanase |
|
|
Secreted endoglucanase |
| CRON 11. | |||||
| SCO0643 |
|
*
Streptomyces coelicolor A3(2) Site: position = -74 score = 6.26602 sequence = CCTTGGGAGCGCTCCCATGC Gene: SCO0643: Putative secreted cellulose-binding protein |
|
|
Putative secreted cellulose-binding protein |
| CRON 12. | |||||
| celA2 |
*
Streptomyces avermitilis MA-4680 Site: position = -209 score = 6.27626 sequence = CAGTGGGAGCGCTCCCATAT Site: position = -66 score = 5.14929 sequence = CAGTGGGAGCGATTCCATCA Gene: SAV_1854: Predicted endo-1,4-beta-glucanase |
|
|
|
Predicted endo-1,4-beta-glucanase |
| cbhA |
Gene: SAV_1853: 1,4-beta-cellobiohydrolase A (EC 3.2.1.91) |
*
Streptomyces coelicolor A3(2) Site: position = -318 score = 5.14929 sequence = CAGTGGGAGCGGTTCCATCA Gene: SCO6548: 1,4-beta-cellobiohydrolase A (EC 3.2.1.91) |
|
*
Streptomyces scabiei 87.22 Site: position = -314 score = 6.27626 sequence = CAGTGGGAGCGCTCCCATAT Site: position = -161 score = 5.26179 sequence = CAGTGGGAGCGGTTCCACCA Gene: SCAB_17001: 1,4-beta-cellobiohydrolase A (EC 3.2.1.91) |
1,4-beta-cellobiohydrolase A (EC 3.2.1.91) |
| CRON 13. | |||||
| cebE |
*
Streptomyces avermitilis MA-4680 Site: position = -134 score = 6.69021 sequence = TTGTGGGAGCGCTCCCACGG Gene: SAV_5256: Cellobiose specific ABC transporter, substrate-binding protein |
*2
Streptomyces coelicolor A3(2) Site: position = -147 score = 6.64156 sequence = TTGTGGGAGCGCTCCCACAC Gene: SCO2795: Cellobiose specific ABC transporter, substrate-binding protein Gene: SCO7555: Cellobiose specific ABC transporter, substrate-binding protein |
*2
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -55 score = 5.48044 sequence = ATTTGAGAGCGCTCTCAAGG Gene: SGR_3212: Cellobiose specific ABC transporter, substrate-binding protein Site: position = -124 score = 6.31836 sequence = GCATGGGAGCGCTCCCACTC Gene: SGR_4735: Cellobiose specific ABC transporter, substrate-binding protein |
*2
Streptomyces scabiei 87.22 Gene: SCAB_2421: Cellobiose specific ABC transporter, substrate-binding protein Site: position = -133 score = 6.69021 sequence = TCGTGGGAGCGCTCCCACAG Gene: SCAB_57751: Cellobiose specific ABC transporter, substrate-binding protein |
Cellobiose specific ABC transporter, substrate-binding protein |
| cebF |
Gene: SAV_5255: Cellobiose specific ABC transporter, permease protein 1 |
2
Streptomyces coelicolor A3(2) Gene: SCO2796: Cellobiose specific ABC transporter, permease protein 1 Gene: SCO7556: Cellobiose specific ABC transporter, permease protein 1 |
2
Streptomyces griseus subsp. griseus NBRC 13350 Gene: SGR_3213: Cellobiose specific ABC transporter, permease protein 1 Gene: SGR_4736: Cellobiose specific ABC transporter, permease protein 1 |
2
Streptomyces scabiei 87.22 Gene: SCAB_2411: Cellobiose specific ABC transporter, permease protein 1 Gene: SCAB_57741: Cellobiose specific ABC transporter, permease protein 1 |
Cellobiose specific ABC transporter, permease protein 1 |
| cebG |
Gene: SAV_5254: Cellobiose specific ABC transporter, permease protein 2 |
2
Streptomyces coelicolor A3(2) Gene: SCO2797: Cellobiose specific ABC transporter, permease protein 2 Gene: SCO7557: Cellobiose specific ABC transporter, permease protein 2 |
2
Streptomyces griseus subsp. griseus NBRC 13350 Gene: SGR_3214: Cellobiose specific ABC transporter, permease protein 2 Gene: SGR_4737: Cellobiose specific ABC transporter, permease protein 2 |
2
Streptomyces scabiei 87.22 Gene: SCAB_2401: Cellobiose specific ABC transporter, permease protein 2 Gene: SCAB_57731: Cellobiose specific ABC transporter, permease protein 2 |
Cellobiose specific ABC transporter, permease protein 2 |
| bglC2 |
*
Streptomyces avermitilis MA-4680 Site: position = -88 score = 5.6501 sequence = CGATGGGAGCGCTTCCATGC Gene: SAV_5253: Beta-glucosidase (EC 3.2.1.21) |
*2
Streptomyces coelicolor A3(2) Site: position = -16 score = 5.9029 sequence = CTATGGGAGCGCTTCCATGC Gene: SCO2798: Beta-glucosidase (EC 3.2.1.21) Gene: SCO7558: Beta-glucosidase (EC 3.2.1.21) |
*2
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -18 score = 5.73947 sequence = CCCAGGGAGCGCTCCCACAT Gene: SGR_4738: Beta-glucosidase (EC 3.2.1.21) Gene: SGR_3215: Beta-glucosidase (EC 3.2.1.21) |
*2
Streptomyces scabiei 87.22 Gene: SCAB_2391: Beta-glucosidase (EC 3.2.1.21) Site: position = -16 score = 5.80608 sequence = CAATGGGAGCGCTTCCATGC Gene: SCAB_57721: Beta-glucosidase (EC 3.2.1.21) |
Beta-glucosidase (EC 3.2.1.21) |
| CRON 14. | |||||
| gunA |
*
Streptomyces avermitilis MA-4680 Site: position = 3 score = 5.88303 sequence = AGGTGGGAGCGCTCCCATAT Gene: SAV_2254: Endoglucanase A (EC 3.2.1.4) |
Gene: SCO1188: Endoglucanase A (EC 3.2.1.4) |
*
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -334 score = 6.16544 sequence = GTGTGGGAGCGCTCCCAGAT Gene: SGR_199: Endoglucanase A (EC 3.2.1.4) |
*
Streptomyces scabiei 87.22 Site: position = -180 score = 6.0064 sequence = GGGTGGGAGCGCTCCCATGT Gene: SCAB_21081: Endoglucanase A (EC 3.2.1.4) |
Endoglucanase A (EC 3.2.1.4) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |