Regulon of CelR in Streptomyces coelicolor A3(2)

Properties
Regulator type:	Transcription factor
TF locus tag:	SCO2794, SCO7554
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	Cellobiose
Regulog:	CelR - Streptomycetaceae
Statistics of regulated genes:
- Genes	15
- Operons	12
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 49 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By TF family - LacI
By effector - Cellobiose
By pathway - Cellobiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -16 Score: 5.9 Sequence: CTATGGGAGCGCTTCCATGC Locus tag: SCO2798 Name: bglC2 Funciton: Beta-glucosidase (EC 3.2.1.21)
	SCO2798	bglC2	Beta-glucosidase (EC 3.2.1.21)
Position: -62 Score: 5.4 Sequence: CGCTGAGAGCGCTCTCAGAA Locus tag: SCO7559 Name: SCO7559 Funciton: Putative sugar hydrolase
	SCO7559	SCO7559	Putative sugar hydrolase
Position: -53 Score: 5.7 Sequence: GCGTGAGAGCGCTCTCAGGC Locus tag: SCO0716 Name: SCO0716 Funciton: Putative glycosyl hydrolase
	SCO0716	SCO0716	Putative glycosyl hydrolase
Position: -318 Score: 5.1 Sequence: CAGTGGGAGCGGTTCCATCA Locus tag: SCO6548 Name: cbhA Funciton: 1,4-beta-cellobiohydrolase A (EC 3.2.1.91)
	SCO6548	cbhA	1,4-beta-cellobiohydrolase A (EC 3.2.1.91)
Position: -74 Score: 6.3 Sequence: CCTTGGGAGCGCTCCCATGC Locus tag: SCO0643 Name: SCO0643 Funciton: Putative secreted cellulose-binding protein
	SCO0643	SCO0643	Putative secreted cellulose-binding protein
Position: -87 Score: 6 Sequence: AAGTGGGAGCGCTCCCATCA Position: -61 Score: 5.3 Sequence: AGTTGGGAGCGCTCCCGCAC Locus tag: SCO1187 Name: gunA2 Funciton: Endoglucanase A (EC 3.2.1.4)
	SCO1187	gunA2	Endoglucanase A (EC 3.2.1.4)
Position: -85 Score: 5.7 Sequence: CTCTGAGAGCGCTCTCAGAA Locus tag: SCO6665 Name: lamA1 Funciton: Predicted endo-1,3-beta-glucanase
	SCO6665	lamA1	Predicted endo-1,3-beta-glucanase
Position: 29 Score: 6.2 Sequence: CTTTGGGAGCGCTCCCATCG Locus tag: SCO7637 Name: SCO7637 Funciton: Secreted endoglucanase
	SCO7637	SCO7637	Secreted endoglucanase
Position: -54 Score: 6 Sequence: ATTTGGGAGCGCTCCCATTC Locus tag: SCO0765 Name: cel1 Funciton: Secreted endoglucanase
	SCO0765	cel1	Secreted endoglucanase
Position: -221 Score: 5.1 Sequence: TGATGGAACCGCTCCCACTG Position: -79 Score: 6.5 Sequence: CTATGGGAGCGCTCCCACTG Locus tag: SCO6546 Name: cbhB Funciton: 1,4-beta-cellobiohydrolase B (EC 3.2.1.91) Locus tag: SCO6545 Name: celA3 Funciton: Predicted endo-1,4-beta-glucanase
	SCO6546	cbhB	1,4-beta-cellobiohydrolase B (EC 3.2.1.91)
	SCO6545	celA3	Predicted endo-1,4-beta-glucanase
Position: -147 Score: 6.6 Sequence: TTGTGGGAGCGCTCCCACAC Locus tag: SCO2795 Name: cebE Funciton: Cellobiose specific ABC transporter, substrate-binding protein Locus tag: SCO2796 Name: cebF Funciton: Cellobiose specific ABC transporter, permease protein 1 Locus tag: SCO2797 Name: cebG Funciton: Cellobiose specific ABC transporter, permease protein 2
	SCO2795	cebE	Cellobiose specific ABC transporter, substrate-binding protein
	SCO2796	cebF	Cellobiose specific ABC transporter, permease protein 1
	SCO2797	cebG	Cellobiose specific ABC transporter, permease protein 2
Position: -238 Score: 6.6 Sequence: GTGTGGGAGCGCTCCCACAA Locus tag: SCO2794 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, LacI family
	SCO2794	celR	Cellobiose utilization transcriptional regulator CelR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of CelR in Streptomyces coelicolor A3(2)

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --