Regulon of CelR in Streptomyces griseus subsp. griseus NBRC 13350

Properties
Regulator type:	Transcription factor
TF locus tag:	SGR_4739
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	Cellobiose
Regulog:	CelR - Streptomycetaceae
Statistics of regulated genes:
- Genes	11
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 49 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By TF family - LacI
By effector - Cellobiose
By pathway - Cellobiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -334 Score: 6.2 Sequence: GTGTGGGAGCGCTCCCAGAT Locus tag: SGR_199 Name: gunA Funciton: Endoglucanase A (EC 3.2.1.4)
	SGR_199	gunA	Endoglucanase A (EC 3.2.1.4)
Position: -124 Score: 6.3 Sequence: GCATGGGAGCGCTCCCACTC Locus tag: SGR_4735 Name: cebE Funciton: Cellobiose specific ABC transporter, substrate-binding protein Locus tag: SGR_4736 Name: cebF Funciton: Cellobiose specific ABC transporter, permease protein 1 Locus tag: SGR_4737 Name: cebG Funciton: Cellobiose specific ABC transporter, permease protein 2
	SGR_4735	cebE	Cellobiose specific ABC transporter, substrate-binding protein
	SGR_4736	cebF	Cellobiose specific ABC transporter, permease protein 1
	SGR_4737	cebG	Cellobiose specific ABC transporter, permease protein 2
Position: -55 Score: 5.5 Sequence: ATTTGAGAGCGCTCTCAAGG Locus tag: SGR_3212 Name: cebE Funciton: Cellobiose specific ABC transporter, substrate-binding protein Locus tag: SGR_3213 Name: cebF Funciton: Cellobiose specific ABC transporter, permease protein 1 Locus tag: SGR_3214 Name: cebG Funciton: Cellobiose specific ABC transporter, permease protein 2 Locus tag: SGR_3215 Name: bglC2 Funciton: Beta-glucosidase (EC 3.2.1.21)
	SGR_3212	cebE	Cellobiose specific ABC transporter, substrate-binding protein
	SGR_3213	cebF	Cellobiose specific ABC transporter, permease protein 1
	SGR_3214	cebG	Cellobiose specific ABC transporter, permease protein 2
	SGR_3215	bglC2	Beta-glucosidase (EC 3.2.1.21)
Position: -18 Score: 5.7 Sequence: CCCAGGGAGCGCTCCCACAT Locus tag: SGR_4738 Name: bglC2 Funciton: Beta-glucosidase (EC 3.2.1.21)
	SGR_4738	bglC2	Beta-glucosidase (EC 3.2.1.21)
Position: -33 Score: 6.3 Sequence: GATTGGGAGCGCTCCCACAG Locus tag: SGR_2445 Name: celA2 Funciton: Endoglucanase (EC 3.2.1.4)
	SGR_2445	celA2	Endoglucanase (EC 3.2.1.4)
Position: -109 Score: 6.2 Sequence: TCTTGGGAGCGCTCCCAATA Locus tag: SGR_4739 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, LacI family
	SGR_4739	celR	Cellobiose utilization transcriptional regulator CelR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD