Regulon of CelR in Streptomyces avermitilis MA-4680

Properties
Regulator type:	Transcription factor
TF locus tag:	SAV_5257
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	Cellobiose
Regulog:	CelR - Streptomycetaceae
Statistics of regulated genes:
- Genes	14
- Operons	10
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 49 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By TF family - LacI
By effector - Cellobiose
By pathway - Cellobiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -88 Score: 5.7 Sequence: CGATGGGAGCGCTTCCATGC Locus tag: SAV_5253 Name: bglC2 Funciton: Beta-glucosidase (EC 3.2.1.21)
	SAV_5253	bglC2	Beta-glucosidase (EC 3.2.1.21)
Position: -69 Score: 5.4 Sequence: CTCTGAGAGCGCTCTCAATT Locus tag: SAV_1053 Name: SCO7559 Funciton: Putative sugar hydrolase
	SAV_1053	SCO7559	Putative sugar hydrolase
Position: -102 Score: 5.1 Sequence: TTCAGAGAGCGCTCTCAGAC Locus tag: SAV_967 Name: SCO0716 Funciton: Putative glycosyl hydrolase
	SAV_967	SCO0716	Putative glycosyl hydrolase
Position: -209 Score: 6.3 Sequence: CAGTGGGAGCGCTCCCATAT Position: -66 Score: 5.1 Sequence: CAGTGGGAGCGATTCCATCA Locus tag: SAV_1854 Name: celA2 Funciton: Predicted endo-1,4-beta-glucanase Locus tag: SAV_1853 Name: cbhA Funciton: 1,4-beta-cellobiohydrolase A (EC 3.2.1.91)
	SAV_1854	celA2	Predicted endo-1,4-beta-glucanase
	SAV_1853	cbhA	1,4-beta-cellobiohydrolase A (EC 3.2.1.91)
Position: -60 Score: 5.7 Sequence: TCTTGAGAGCGCTCTCAAGG Locus tag: SAV_1764 Name: lamA1 Funciton: Predicted endo-1,3-beta-glucanase
	SAV_1764	lamA1	Predicted endo-1,3-beta-glucanase
Position: 3 Score: 5.9 Sequence: AGGTGGGAGCGCTCCCATAT Locus tag: SAV_2254 Name: gunA Funciton: Endoglucanase A (EC 3.2.1.4)
	SAV_2254	gunA	Endoglucanase A (EC 3.2.1.4)
Position: -218 Score: 5.1 Sequence: TGATGGAATCGCTCCCACTG Position: -75 Score: 6.3 Sequence: ATATGGGAGCGCTCCCACTG Locus tag: SAV_1855 Name: cbhB Funciton: 1,4-beta-cellobiohydrolase B (EC 3.2.1.91) Locus tag: SAV_1856 Name: celA3 Funciton: Predicted endo-1,4-beta-glucanase
	SAV_1855	cbhB	1,4-beta-cellobiohydrolase B (EC 3.2.1.91)
	SAV_1856	celA3	Predicted endo-1,4-beta-glucanase
Position: -134 Score: 6.7 Sequence: TTGTGGGAGCGCTCCCACGG Locus tag: SAV_5256 Name: cebE Funciton: Cellobiose specific ABC transporter, substrate-binding protein Locus tag: SAV_5255 Name: cebF Funciton: Cellobiose specific ABC transporter, permease protein 1 Locus tag: SAV_5254 Name: cebG Funciton: Cellobiose specific ABC transporter, permease protein 2
	SAV_5256	cebE	Cellobiose specific ABC transporter, substrate-binding protein
	SAV_5255	cebF	Cellobiose specific ABC transporter, permease protein 1
	SAV_5254	cebG	Cellobiose specific ABC transporter, permease protein 2
Position: -220 Score: 6.3 Sequence: TTTTGGGAGCGCTCCCAAGA Position: -75 Score: 5.9 Sequence: GAATGGGAGCGCTCCCACCT Position: -51 Score: 5.5 Sequence: TGATGGGAGCGCTCCCGAAC Locus tag: SAV_555 Name: celA1 Funciton: Endoglucanase (EC 3.2.1.4)
	SAV_555	celA1	Endoglucanase (EC 3.2.1.4)
Position: -284 Score: 6.7 Sequence: CCGTGGGAGCGCTCCCACAA Locus tag: SAV_5257 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, LacI family
	SAV_5257	celR	Cellobiose utilization transcriptional regulator CelR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of CelR in Streptomyces avermitilis MA-4680

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --