Orthologous regulated operons containing cebE gene

Properties
Regulog:	CelR - Streptomycetaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	Cellobiose
Phylum:	Actinobacteria

Built upon 49 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Streptomyces avermitilis MA-4680
Position: -134 Score: 6.69021 Sequence: TTGTGGGAGCGCTCCCACGG Locus tag: SAV_5256 Name: cebE Funciton: Cellobiose specific ABC transporter, substrate-binding protein Locus tag: SAV_5255 Name: cebF Funciton: Cellobiose specific ABC transporter, permease protein 1 Locus tag: SAV_5254 Name: cebG Funciton: Cellobiose specific ABC transporter, permease protein 2
cebE-cebF-cebG	-134	6.7	TTGTGGGAGCGCTCCCACGG	SAV_5256
Streptomyces coelicolor A3(2)
Position: -147 Score: 6.64156 Sequence: TTGTGGGAGCGCTCCCACAC Locus tag: SCO2795 Name: cebE Funciton: Cellobiose specific ABC transporter, substrate-binding protein Locus tag: SCO2796 Name: cebF Funciton: Cellobiose specific ABC transporter, permease protein 1 Locus tag: SCO2797 Name: cebG Funciton: Cellobiose specific ABC transporter, permease protein 2
cebE-cebF-cebG	-147	6.6	TTGTGGGAGCGCTCCCACAC	SCO2795
Streptomyces griseus subsp. griseus NBRC 13350
Position: -55 Score: 5.48044 Sequence: ATTTGAGAGCGCTCTCAAGG Locus tag: SGR_3212 Name: cebE Funciton: Cellobiose specific ABC transporter, substrate-binding protein Locus tag: SGR_3213 Name: cebF Funciton: Cellobiose specific ABC transporter, permease protein 1 Locus tag: SGR_3214 Name: cebG Funciton: Cellobiose specific ABC transporter, permease protein 2 Locus tag: SGR_3215 Name: bglC2 Funciton: Beta-glucosidase (EC 3.2.1.21)
cebE-cebF-cebG-bglC2	-55	5.5	ATTTGAGAGCGCTCTCAAGG	SGR_3212
Streptomyces scabiei 87.22
Position: -133 Score: 6.69021 Sequence: TCGTGGGAGCGCTCCCACAG Locus tag: SCAB_57751 Name: cebE Funciton: Cellobiose specific ABC transporter, substrate-binding protein Locus tag: SCAB_57741 Name: cebF Funciton: Cellobiose specific ABC transporter, permease protein 1 Locus tag: SCAB_57731 Name: cebG Funciton: Cellobiose specific ABC transporter, permease protein 2
cebE-cebF-cebG	-133	6.7	TCGTGGGAGCGCTCCCACAG	SCAB_57751