Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing cebG gene

Properties
Regulog: CelR - Streptomycetaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: Cellobiose
Phylum: Actinobacteria
Built upon 49 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptomyces avermitilis MA-4680
Position: -134
Score: 6.69021
Sequence: TTGTGGGAGCGCTCCCACGG
Locus tag: SAV_5256
Name: cebE
Funciton: Cellobiose specific ABC transporter, substrate-binding protein
Locus tag: SAV_5255
Name: cebF
Funciton: Cellobiose specific ABC transporter, permease protein 1
Locus tag: SAV_5254
Name: cebG
Funciton: Cellobiose specific ABC transporter, permease protein 2
cebE-cebF-cebG -134 6.7 TTGTGGGAGCGCTCCCACGG SAV_5256
Streptomyces coelicolor A3(2)
Position: -147
Score: 6.64156
Sequence: TTGTGGGAGCGCTCCCACAC
Locus tag: SCO2795
Name: cebE
Funciton: Cellobiose specific ABC transporter, substrate-binding protein
Locus tag: SCO2796
Name: cebF
Funciton: Cellobiose specific ABC transporter, permease protein 1
Locus tag: SCO2797
Name: cebG
Funciton: Cellobiose specific ABC transporter, permease protein 2
cebE-cebF-cebG -147 6.6 TTGTGGGAGCGCTCCCACAC SCO2795
Streptomyces griseus subsp. griseus NBRC 13350
Position: -55
Score: 5.48044
Sequence: ATTTGAGAGCGCTCTCAAGG
Locus tag: SGR_3212
Name: cebE
Funciton: Cellobiose specific ABC transporter, substrate-binding protein
Locus tag: SGR_3213
Name: cebF
Funciton: Cellobiose specific ABC transporter, permease protein 1
Locus tag: SGR_3214
Name: cebG
Funciton: Cellobiose specific ABC transporter, permease protein 2
Locus tag: SGR_3215
Name: bglC2
Funciton: Beta-glucosidase (EC 3.2.1.21)
cebE-cebF-cebG-bglC2 -55 5.5 ATTTGAGAGCGCTCTCAAGG SGR_3212
Streptomyces scabiei 87.22
Position: -133
Score: 6.69021
Sequence: TCGTGGGAGCGCTCCCACAG
Locus tag: SCAB_57751
Name: cebE
Funciton: Cellobiose specific ABC transporter, substrate-binding protein
Locus tag: SCAB_57741
Name: cebF
Funciton: Cellobiose specific ABC transporter, permease protein 1
Locus tag: SCAB_57731
Name: cebG
Funciton: Cellobiose specific ABC transporter, permease protein 2
cebE-cebF-cebG -133 6.7 TCGTGGGAGCGCTCCCACAG SCAB_57751