Regulog BglR - Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Alteromonadales
- By TF family - LacI
- By effector - Beta-glucoside
- By pathway - Beta-glucosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Alteromonadales bacterium TW-7 | 14 | 6 |
| Alteromonas macleodii 'Deep ecotype' | 5 | 2 |
| Colwellia psychrerythraea 34H | 12 | 4 |
| Glaciecola sp. HTCC2999 | 10 | 4 |
| Idiomarina baltica OS145 | 7 | 3 |
| Idiomarina loihiensis L2TR | ||
| Pseudoalteromonas atlantica T6c | ||
| Pseudoalteromonas haloplanktis TAC125 | ||
| Pseudoalteromonas tunicata D2 | 7 | 3 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| lamA |
*
Alteromonadales bacterium TW-7 Site: position = -92 score = 6.14378 sequence = AAATGTAAGCGCTTACAGAA Site: position = -120 score = 6.45193 sequence = ATTTGTAAGCGCTTACAATT Gene: ATW7_02192: Beta-glucanase precursor (EC 3.2.1.73) |
Gene: MADE_03791: Beta-glucanase precursor (EC 3.2.1.73) |
|
*
Glaciecola sp. HTCC2999 Site: position = -110 score = 5.94706 sequence = CTGTGGAAGCGCTTACATTT Site: position = -68 score = 6.235 sequence = AGATGTAAGCGCTTACATCA Gene: GHTCC_010100001564: Beta-glucanase precursor (EC 3.2.1.73) |
*
Idiomarina baltica OS145 Site: position = -64 score = 6.39654 sequence = TTGTGAAAGCGCTTACATTT Gene: OS145_00595: Beta-glucanase precursor (EC 3.2.1.73) |
|
|
|
*
Pseudoalteromonas tunicata D2 Site: position = -91 score = 6.32222 sequence = AAATGGAAGCGCTTACATAA Site: position = -132 score = 6.40119 sequence = TTATGAAAGCGCTTACATTC Gene: PTD2_20417: Beta-glucanase precursor (EC 3.2.1.73) |
Beta-glucanase precursor (EC 3.2.1.73) |
| omp(Bgl)2 |
Gene: ATW7_02187: Predicted beta-glucoside specific TonB-dependent outer membrane receptor |
2
Alteromonas macleodii 'Deep ecotype' Gene: MADE_03790: Predicted beta-glucoside specific TonB-dependent outer membrane receptor Gene: MADE_03792: Predicted beta-glucoside specific TonB-dependent outer membrane receptor |
|
Gene: GHTCC_010100001569: Predicted beta-glucoside specific TonB-dependent outer membrane receptor |
Gene: OS145_00600: Predicted beta-glucoside specific TonB-dependent outer membrane receptor |
|
|
|
Gene: PTD2_20412: Predicted beta-glucoside specific TonB-dependent outer membrane receptor |
Predicted beta-glucoside specific TonB-dependent outer membrane receptor |
| CRON 2. | ||||||||||
| omp(Bgl)1 |
*
Alteromonadales bacterium TW-7 Site: position = -100 score = 4.71716 sequence = TTCTGGAAGCGCTTCCACAC Site: position = -140 score = 4.98484 sequence = TTCTGGAAGCGCTTCCACAT Gene: ATW7_07974: Predicted beta-glucoside specific TonB-dependent outer membrane receptor |
|
*
Colwellia psychrerythraea 34H Site: position = -165 score = 6.20506 sequence = TTATGTAAGCGCTTACACCA Site: position = -449 score = 6.52281 sequence = AAATGTAAGCGCTTACAAAT Site: position = -240 score = 6.76645 sequence = TTATGTAAGCGCTTACATTT Gene: CPS_3698: Predicted beta-glucoside specific TonB-dependent outer membrane receptor |
|
|
|
Gene: Patl_3278: Predicted beta-glucoside specific TonB-dependent outer membrane receptor |
|
|
Predicted beta-glucoside specific TonB-dependent outer membrane receptor |
| trpH1 |
Gene: ATW7_07979: putative tryptophan halogenase |
|
Gene: CPS_3699: putative tryptophan halogenase |
|
|
|
|
|
|
putative tryptophan halogenase |
| trpH2 |
Gene: ATW7_07984: putative tryptophan halogenase |
|
Gene: CPS_3700: putative tryptophan halogenase |
|
|
|
Gene: Patl_3277: putative tryptophan halogenase |
|
|
putative tryptophan halogenase |
| CRON 3. | ||||||||||
| glcP |
*
Alteromonadales bacterium TW-7 Site: position = -132 score = 6.19035 sequence = CTGTGAAAGCGCTTACATTT Gene: ATW7_07849: Predicted glucose transporter in beta-glucoside utilization gene cluster |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -64 score = 6.07976 sequence = AGATGTAAGCGCTTTCAAAT Site: position = -96 score = 6.60477 sequence = TTATGTAAGCGCTTACAAAA Gene: MADE_03795: Predicted glucose transporter in beta-glucoside utilization gene cluster |
*
Colwellia psychrerythraea 34H Site: position = -271 score = 6.19164 sequence = TTATGTGAGCGCTTACAAAA Site: position = -216 score = 5.98801 sequence = GGATGTAAGCGCTTACATTT Gene: CPS_3705: Predicted glucose transporter in beta-glucoside utilization gene cluster |
*
Glaciecola sp. HTCC2999 Site: position = -72 score = 6.18095 sequence = CAATGAAAGCGCTTTCATTT Gene: GHTCC_010100001604: Predicted glucose transporter in beta-glucoside utilization gene cluster |
*
Idiomarina baltica OS145 Site: position = -69 score = 6.32222 sequence = ACATGAAAGCGCTTACATAA Gene: OS145_00610: Predicted glucose transporter in beta-glucoside utilization gene cluster |
|
|
|
*
Pseudoalteromonas tunicata D2 Site: position = -124 score = 6.39654 sequence = ATGTGAAAGCGCTTACATTT Site: position = -183 score = 6.45193 sequence = TTTTGTAAGCGCTTACAATT Gene: PTD2_03951: Predicted glucose transporter in beta-glucoside utilization gene cluster |
Predicted glucose transporter in beta-glucoside utilization gene cluster |
| bglA2 |
*2
Alteromonadales bacterium TW-7 Site: position = -173 score = 5.35986 sequence = AGTTGGAAGCGCTTCCATAA Gene: ATW7_07989: Periplasmic beta-glucosidase (EC 3.2.1.21) Gene: ATW7_07844: Periplasmic beta-glucosidase (EC 3.2.1.21) |
Gene: MADE_03794: Periplasmic beta-glucosidase (EC 3.2.1.21) |
|
Gene: GHTCC_010100001599: Periplasmic beta-glucosidase (EC 3.2.1.21) |
Gene: OS145_00605: Periplasmic beta-glucosidase (EC 3.2.1.21) |
|
|
|
Gene: PTD2_03946: Periplasmic beta-glucosidase (EC 3.2.1.21) |
Periplasmic beta-glucosidase (EC 3.2.1.21) |
| lamA |
|
|
|
Gene: GHTCC_010100001594: Predicted glucose transporter in beta-glucoside utilization gene cluster |
|
|
|
|
|
Predicted glucose transporter in beta-glucoside utilization gene cluster |
| CRON 4. | ||||||||||
| bglA1 |
*2
Alteromonadales bacterium TW-7 Site: position = -129 score = 4.75321 sequence = ATATGGAAGCGCTTCCTGAA Site: position = -71 score = 5.53425 sequence = TTATGGAAGCGCTTCCAACT Gene: ATW7_07994: Cytoplasmic beta-glucosidase (EC 3.2.1.21) Site: position = -146 score = 5.97921 sequence = AAATGTAAGCGCTTTCACAG Gene: ATW7_07854: Cytoplasmic beta-glucosidase (EC 3.2.1.21) |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -130 score = 6.57084 sequence = TTTTGTAAGCGCTTACATAA Site: position = -162 score = 6.28845 sequence = ATTTGAAAGCGCTTACATCT Gene: MADE_03797: Cytoplasmic beta-glucosidase (EC 3.2.1.21) |
*
Colwellia psychrerythraea 34H Site: position = -126 score = 6.21061 sequence = AAATGTAAGCGCTTACATCC Site: position = -71 score = 5.98401 sequence = TTTTGTAAGCGCTCACATAA Gene: CPS_3706: Cytoplasmic beta-glucosidase (EC 3.2.1.21) |
*
Glaciecola sp. HTCC2999 Site: position = -103 score = 6.25821 sequence = AAATGAAAGCGCTTTCATTG Gene: GHTCC_010100001609: Cytoplasmic beta-glucosidase (EC 3.2.1.21) |
*
Idiomarina baltica OS145 Site: position = -73 score = 6.27763 sequence = TTATGTAAGCGCTTTCATGT Gene: OS145_00615: Cytoplasmic beta-glucosidase (EC 3.2.1.21) |
|
|
|
*
Pseudoalteromonas tunicata D2 Site: position = -52 score = 6.34858 sequence = AATTGTAAGCGCTTACAAAA Site: position = -111 score = 6.10814 sequence = AAATGTAAGCGCTTTCACAT Gene: PTD2_03956: Cytoplasmic beta-glucosidase (EC 3.2.1.21) |
Cytoplasmic beta-glucosidase (EC 3.2.1.21) |
| bglT2 |
Gene: ATW7_07999: Predicted beta-glucoside transporter, MFS family |
|
Gene: CPS_3707: Predicted beta-glucoside transporter, MFS family |
|
|
|
Gene: Patl_3275: Predicted beta-glucoside transporter, MFS family |
|
|
Predicted beta-glucoside transporter, MFS family |
| bglT |
Gene: ATW7_07859: Predicted beta-glucoside transporter, GPH family |
|
Gene: CPS_3708: Predicted beta-glucoside transporter, GPH family |
|
Gene: OS145_00620: Predicted beta-glucoside transporter, GPH family |
|
|
|
Gene: PTD2_03961: Predicted beta-glucoside transporter, GPH family |
Predicted beta-glucoside transporter, GPH family |
| bglR |
2
Alteromonadales bacterium TW-7 Gene: ATW7_08004: Transcriptional regulator of beta-glucosides utilization, LacI family Gene: ATW7_07864: Transcriptional regulator of beta-glucosides utilization, LacI family |
2
Alteromonas macleodii 'Deep ecotype' Gene: MADE_03798: Transcriptional regulator of beta-glucosides utilization, LacI family Gene: MADE_04075: Transcriptional regulator of beta-glucosides utilization, LacI family |
Gene: CPS_3709: Transcriptional regulator of beta-glucosides utilization, LacI family |
Gene: GHTCC_010100001614: Transcriptional regulator of beta-glucosides utilization, LacI family |
Gene: OS145_00625: Transcriptional regulator of beta-glucosides utilization, LacI family |
|
|
|
Gene: PTD2_03966: Transcriptional regulator of beta-glucosides utilization, LacI family |
Transcriptional regulator of beta-glucosides utilization, LacI family |
| glk |
|
|
Gene: CPS_3710: Glucokinase, ROK family (EC 2.7.1.2) |
|
|
|
|
|
|
Glucokinase, ROK family (EC 2.7.1.2) |
| bglT3 |
|
Gene: MADE_03799: Predicted beta-glucoside transporter, MFS family |
|
Gene: GHTCC_010100001619: Predicted beta-glucoside transporter, MFS family |
|
|
|
|
|
Predicted beta-glucoside transporter, MFS family |
| GHTCC_010100001624 |
|
|
|
Gene: GHTCC_010100001624: TonB-dependent receptor |
|
|
|
|
|
TonB-dependent receptor |
| CRON 5. | ||||||||||
| GHTCC_010100003724 |
|
|
|
*
Glaciecola sp. HTCC2999 Site: position = -99 score = 6.68448 sequence = AAATGTAAGCGCTTACATTT Gene: GHTCC_010100003724: Endo-1,3(4)-beta-glucanase |
|
|
|
|
|
Endo-1,3(4)-beta-glucanase |
| CRON 6. | ||||||||||
| CPS_3697 |
|
|
*
Colwellia psychrerythraea 34H Site: position = -108 score = 6.59222 sequence = ATTTGTAAGCGCTTACATTT Gene: CPS_3697: Predicted beta-glucoside transporter, GPH family |
|
|
|
|
|
|
Predicted beta-glucoside transporter, GPH family |
| celP |
|
|
Gene: CPS_3696: Cellobiose phosphorylase |
|
|
|
|
|
|
Cellobiose phosphorylase |
| gntK |
|
|
Gene: CPS_3695: Gluconokinase (EC 2.7.1.12) |
|
|
|
|
|
|
Gluconokinase (EC 2.7.1.12) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |