Regulon of BglR in Colwellia psychrerythraea 34H

Properties
Regulator type:	Transcription factor
TF locus tag:	CPS_3709
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Regulog:	BglR - Alteromonadales
Statistics of regulated genes:
- Genes	12
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 35 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By TF family - LacI
By effector - Beta-glucoside
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -449 Score: 6.5 Sequence: AAATGTAAGCGCTTACAAAT Position: -240 Score: 6.8 Sequence: TTATGTAAGCGCTTACATTT Position: -165 Score: 6.2 Sequence: TTATGTAAGCGCTTACACCA Locus tag: CPS_3698 Name: omp(Bgl)1 Funciton: Predicted beta-glucoside specific TonB-dependent outer membrane receptor Locus tag: CPS_3699 Name: trpH1 Funciton: putative tryptophan halogenase Locus tag: CPS_3700 Name: trpH2 Funciton: putative tryptophan halogenase
	CPS_3698	omp(Bgl)1	Predicted beta-glucoside specific TonB-dependent outer membrane receptor
	CPS_3699	trpH1	putative tryptophan halogenase
	CPS_3700	trpH2	putative tryptophan halogenase
Position: -271 Score: 6.2 Sequence: TTATGTGAGCGCTTACAAAA Position: -216 Score: 6 Sequence: GGATGTAAGCGCTTACATTT Locus tag: CPS_3705 Name: glcP Funciton: Predicted glucose transporter in beta-glucoside utilization gene cluster
	CPS_3705	glcP	Predicted glucose transporter in beta-glucoside utilization gene cluster
Position: -126 Score: 6.2 Sequence: AAATGTAAGCGCTTACATCC Position: -71 Score: 6 Sequence: TTTTGTAAGCGCTCACATAA Locus tag: CPS_3706 Name: bglA1 Funciton: Cytoplasmic beta-glucosidase (EC 3.2.1.21) Locus tag: CPS_3707 Name: bglT2 Funciton: Predicted beta-glucoside transporter, MFS family Locus tag: CPS_3708 Name: bglT Funciton: Predicted beta-glucoside transporter, GPH family Locus tag: CPS_3709 Name: bglR Funciton: Transcriptional regulator of beta-glucosides utilization, LacI family Locus tag: CPS_3710 Name: glk Funciton: Glucokinase, ROK family (EC 2.7.1.2)
	CPS_3706	bglA1	Cytoplasmic beta-glucosidase (EC 3.2.1.21)
	CPS_3707	bglT2	Predicted beta-glucoside transporter, MFS family
	CPS_3708	bglT	Predicted beta-glucoside transporter, GPH family
	CPS_3709	bglR	Transcriptional regulator of beta-glucosides utilization, LacI family
	CPS_3710	glk	Glucokinase, ROK family (EC 2.7.1.2)
Position: -108 Score: 6.6 Sequence: ATTTGTAAGCGCTTACATTT Locus tag: CPS_3697 Name: CPS_3697 Funciton: Predicted beta-glucoside transporter, GPH family Locus tag: CPS_3696 Name: celP Funciton: Cellobiose phosphorylase Locus tag: CPS_3695 Name: gntK Funciton: Gluconokinase (EC 2.7.1.12)
	CPS_3697	CPS_3697	Predicted beta-glucoside transporter, GPH family
	CPS_3696	celP	Cellobiose phosphorylase
	CPS_3695	gntK	Gluconokinase (EC 2.7.1.12)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD