Regulon of BglR in Pseudoalteromonas tunicata D2

Properties
Regulator type:	Transcription factor
TF locus tag:	PTD2_03966
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Regulog:	BglR - Alteromonadales
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 35 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By TF family - LacI
By effector - Beta-glucoside
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -132 Score: 6.4 Sequence: TTATGAAAGCGCTTACATTC Position: -91 Score: 6.3 Sequence: AAATGGAAGCGCTTACATAA Locus tag: PTD2_20417 Name: lamA Funciton: Beta-glucanase precursor (EC 3.2.1.73) Locus tag: PTD2_20412 Name: omp(Bgl)2 Funciton: Predicted beta-glucoside specific TonB-dependent outer membrane receptor
	PTD2_20417	lamA	Beta-glucanase precursor (EC 3.2.1.73)
	PTD2_20412	omp(Bgl)2	Predicted beta-glucoside specific TonB-dependent outer membrane receptor
Position: -183 Score: 6.5 Sequence: TTTTGTAAGCGCTTACAATT Position: -124 Score: 6.4 Sequence: ATGTGAAAGCGCTTACATTT Locus tag: PTD2_03951 Name: glcP Funciton: Predicted glucose transporter in beta-glucoside utilization gene cluster Locus tag: PTD2_03946 Name: bglA2 Funciton: Periplasmic beta-glucosidase (EC 3.2.1.21)
	PTD2_03951	glcP	Predicted glucose transporter in beta-glucoside utilization gene cluster
	PTD2_03946	bglA2	Periplasmic beta-glucosidase (EC 3.2.1.21)
Position: -111 Score: 6.1 Sequence: AAATGTAAGCGCTTTCACAT Position: -52 Score: 6.3 Sequence: AATTGTAAGCGCTTACAAAA Locus tag: PTD2_03956 Name: bglA1 Funciton: Cytoplasmic beta-glucosidase (EC 3.2.1.21) Locus tag: PTD2_03961 Name: bglT Funciton: Predicted beta-glucoside transporter, GPH family Locus tag: PTD2_03966 Name: bglR Funciton: Transcriptional regulator of beta-glucosides utilization, LacI family
	PTD2_03956	bglA1	Cytoplasmic beta-glucosidase (EC 3.2.1.21)
	PTD2_03961	bglT	Predicted beta-glucoside transporter, GPH family
	PTD2_03966	bglR	Transcriptional regulator of beta-glucosides utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD