Orthologous regulated operons containing bglT2 gene

Properties
Regulog:	BglR - Alteromonadales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Phylum:	Proteobacteria/gamma

Built upon 35 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Alteromonadales bacterium TW-7
Position: -129 Score: 4.75321 Sequence: ATATGGAAGCGCTTCCTGAA Position: -71 Score: 5.53425 Sequence: TTATGGAAGCGCTTCCAACT Locus tag: ATW7_07994 Name: bglA1 Funciton: Cytoplasmic beta-glucosidase (EC 3.2.1.21) Locus tag: ATW7_07999 Name: bglT2 Funciton: Predicted beta-glucoside transporter, MFS family Locus tag: ATW7_08004 Name: bglR Funciton: Transcriptional regulator of beta-glucosides utilization, LacI family
bglA1-bglT2-bglR	-129	4.8	ATATGGAAGCGCTTCCTGAA	ATW7_07994
	-71	5.5	TTATGGAAGCGCTTCCAACT
Colwellia psychrerythraea 34H
Position: -126 Score: 6.21061 Sequence: AAATGTAAGCGCTTACATCC Position: -71 Score: 5.98401 Sequence: TTTTGTAAGCGCTCACATAA Locus tag: CPS_3706 Name: bglA1 Funciton: Cytoplasmic beta-glucosidase (EC 3.2.1.21) Locus tag: CPS_3707 Name: bglT2 Funciton: Predicted beta-glucoside transporter, MFS family Locus tag: CPS_3708 Name: bglT Funciton: Predicted beta-glucoside transporter, GPH family Locus tag: CPS_3709 Name: bglR Funciton: Transcriptional regulator of beta-glucosides utilization, LacI family Locus tag: CPS_3710 Name: glk Funciton: Glucokinase, ROK family (EC 2.7.1.2)
bglA1-bglT2-bglT-bglR-glk	-126	6.2	AAATGTAAGCGCTTACATCC	CPS_3706
	-71	6	TTTTGTAAGCGCTCACATAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --