Orthologous regulated operons containing lamA gene

Properties
Regulog:	BglR - Alteromonadales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Phylum:	Proteobacteria/gamma

Built upon 35 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Glaciecola sp. HTCC2999
Position: -72 Score: 6.18095 Sequence: CAATGAAAGCGCTTTCATTT Locus tag: GHTCC_010100001604 Name: glcP Funciton: Predicted glucose transporter in beta-glucoside utilization gene cluster Locus tag: GHTCC_010100001599 Name: bglA2 Funciton: Periplasmic beta-glucosidase (EC 3.2.1.21) Locus tag: GHTCC_010100001594 Name: lamA Funciton: Predicted glucose transporter in beta-glucoside utilization gene cluster
glcP-bglA2-lamA	-72	6.2	CAATGAAAGCGCTTTCATTT	GHTCC_010100001604

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --