Orthologous regulated operons containing GHTCC_010100001624 gene

Properties
Regulog:	BglR - Alteromonadales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Phylum:	Proteobacteria/gamma

Built upon 35 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Glaciecola sp. HTCC2999
Position: -103 Score: 6.25821 Sequence: AAATGAAAGCGCTTTCATTG Locus tag: GHTCC_010100001609 Name: bglA1 Funciton: Cytoplasmic beta-glucosidase (EC 3.2.1.21) Locus tag: GHTCC_010100001614 Name: bglR Funciton: Transcriptional regulator of beta-glucosides utilization, LacI family Locus tag: GHTCC_010100001619 Name: bglT3 Funciton: Predicted beta-glucoside transporter, MFS family Locus tag: GHTCC_010100001624 Name: null Funciton: TonB-dependent receptor
bglA1-bglR-bglT3-GHTCC_010100001624	-103	6.3	AAATGAAAGCGCTTTCATTG	GHTCC_010100001609

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --