Regulon of BglR in Glaciecola sp. HTCC2999

Properties
Regulator type:	Transcription factor
TF locus tag:	GHTCC_010100001614
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Regulog:	BglR - Alteromonadales
Statistics of regulated genes:
- Genes	10
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 35 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By TF family - LacI
By effector - Beta-glucoside
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -103 Score: 6.3 Sequence: AAATGAAAGCGCTTTCATTG Locus tag: GHTCC_010100001609 Name: bglA1 Funciton: Cytoplasmic beta-glucosidase (EC 3.2.1.21) Locus tag: GHTCC_010100001614 Name: bglR Funciton: Transcriptional regulator of beta-glucosides utilization, LacI family Locus tag: GHTCC_010100001619 Name: bglT3 Funciton: Predicted beta-glucoside transporter, MFS family Locus tag: GHTCC_010100001624 Name: null Funciton: TonB-dependent receptor
	GHTCC_010100001609	bglA1	Cytoplasmic beta-glucosidase (EC 3.2.1.21)
	GHTCC_010100001614	bglR	Transcriptional regulator of beta-glucosides utilization, LacI family
	GHTCC_010100001619	bglT3	Predicted beta-glucoside transporter, MFS family
	GHTCC_010100001624		TonB-dependent receptor
Position: -99 Score: 6.7 Sequence: AAATGTAAGCGCTTACATTT Locus tag: GHTCC_010100003724 Name: GHTCC_010100003724 Funciton: Endo-1,3(4)-beta-glucanase
	GHTCC_010100003724	GHTCC_010100003724	Endo-1,3(4)-beta-glucanase
Position: -110 Score: 5.9 Sequence: CTGTGGAAGCGCTTACATTT Position: -68 Score: 6.2 Sequence: AGATGTAAGCGCTTACATCA Locus tag: GHTCC_010100001564 Name: lamA Funciton: Beta-glucanase precursor (EC 3.2.1.73) Locus tag: GHTCC_010100001569 Name: omp(Bgl)2 Funciton: Predicted beta-glucoside specific TonB-dependent outer membrane receptor
	GHTCC_010100001564	lamA	Beta-glucanase precursor (EC 3.2.1.73)
	GHTCC_010100001569	omp(Bgl)2	Predicted beta-glucoside specific TonB-dependent outer membrane receptor
Position: -72 Score: 6.2 Sequence: CAATGAAAGCGCTTTCATTT Locus tag: GHTCC_010100001604 Name: glcP Funciton: Predicted glucose transporter in beta-glucoside utilization gene cluster Locus tag: GHTCC_010100001599 Name: bglA2 Funciton: Periplasmic beta-glucosidase (EC 3.2.1.21) Locus tag: GHTCC_010100001594 Name: lamA Funciton: Predicted glucose transporter in beta-glucoside utilization gene cluster
	GHTCC_010100001604	glcP	Predicted glucose transporter in beta-glucoside utilization gene cluster
	GHTCC_010100001599	bglA2	Periplasmic beta-glucosidase (EC 3.2.1.21)
	GHTCC_010100001594	lamA	Predicted glucose transporter in beta-glucoside utilization gene cluster

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD