Orthologous regulated operons containing GHTCC_010100003724 gene

Properties
Regulog:	BglR - Alteromonadales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Phylum:	Proteobacteria/gamma

Built upon 35 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Glaciecola sp. HTCC2999
Position: -99 Score: 6.68448 Sequence: AAATGTAAGCGCTTACATTT Locus tag: GHTCC_010100003724 Name: GHTCC_010100003724 Funciton: Endo-1,3(4)-beta-glucanase
GHTCC_010100003724	-99	6.7	AAATGTAAGCGCTTACATTT	GHTCC_010100003724

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --