Regulog SoxR - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By trascription factor - SoxR
- By TF family - MerR
- By effector - Paraquat
- By pathway - Superoxide stress response
| Genome | Genes | Operons |
|---|---|---|
| Sinorhizobium meliloti 1021 | 4 | 4 |
| Rhizobium sp. NGR234 | 3 | 3 |
| Rhizobium leguminosarum bv. viciae 3841 | 4 | 4 |
| Rhizobium etli CFN 42 | 2 | 2 |
| Agrobacterium tumefaciens str. C58 (Cereon) | 6 | 4 |
| Mesorhizobium sp. BNC1 | ||
| Mesorhizobium loti MAFF303099 | 3 | 3 |
| Brucella melitensis 16M | ||
| Bartonella quintana str. Toulouse | ||
| Rhodopseudomonas palustris CGA009 | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | ||
| Nitrobacter winogradskyi Nb-255 | ||
| Azorhizobium caulinodans ORS 571 | ||
| Xanthobacter autotrophicus Py2 | 2 | 2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| soxR |
*
Sinorhizobium meliloti 1021 Site: position = -31 score = 6.50664 sequence = ACCTCAACTATAGTTGAGGT Gene: SMc00182: Redox-sensitive transcriptional activator, MerR family |
*
Rhizobium sp. NGR234 Site: position = -31 score = 6.53382 sequence = ACCTCAAGCTTAGTTGAGGT Gene: NGR_c16780: Redox-sensitive transcriptional activator, MerR family |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -29 score = 6.25286 sequence = ACCTCAACTAATCTTGAGGT Gene: RL4397: Redox-sensitive transcriptional activator, MerR family |
*
Rhizobium etli CFN 42 Site: position = -29 score = 5.97121 sequence = ACCTCAACTAATATTGAGGT Gene: RHE_CH03863: Redox-sensitive transcriptional activator, MerR family |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -91 score = 6.13279 sequence = ACCTCAACTATAGTTGAGGA Gene: Atu3915: Redox-sensitive transcriptional activator, MerR family |
|
*
Mesorhizobium loti MAFF303099 Site: position = -37 score = 6.02992 sequence = AGCTCAACATAACTTGAGGT Gene: mlr2720: Redox-sensitive transcriptional activator, MerR family |
|
|
|
|
|
|
|
*
Xanthobacter autotrophicus Py2 Site: position = 26 score = 5.63459 sequence = ACCTCGAGTATGGTTTAGGT Gene: Xaut_1053: Redox-sensitive transcriptional activator, MerR family |
Redox-sensitive transcriptional activator, MerR family |
| CRON 2. | ||||||||||||||||
| PF03358 |
*
Sinorhizobium meliloti 1021 Site: position = -67 score = 6.50664 sequence = ACCTCAACTATAGTTGAGGT Gene: SMc00183: NADPH-dependent FMN reductase |
*
Rhizobium sp. NGR234 Site: position = -68 score = 6.53382 sequence = ACCTCAACTAAGCTTGAGGT Gene: NGR_c16770: NADPH-dependent FMN reductase |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -74 score = 6.25286 sequence = ACCTCAAGATTAGTTGAGGT Gene: RL4398: NADPH-dependent FMN reductase |
|
|
|
|
|
|
|
|
|
|
|
|
NADPH-dependent FMN reductase |
| CRON 3. | ||||||||||||||||
| PF07690 |
*
Sinorhizobium meliloti 1021 Site: position = -62 score = 5.68984 sequence = ACCTCAACCGCGATTGAGGT Gene: SMc01217: Permease of the major facilitator superfamily |
*
Rhizobium sp. NGR234 Site: position = -63 score = 5.69283 sequence = ACCTCAAGAGCGCTTGAGGT Gene: NGR_c15730: Permease of the major facilitator superfamily |
|
|
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -78 score = 5.33207 sequence = ACCTCAATGGCGCTTGAGGT Gene: Atu0942: Permease of the major facilitator superfamily |
|
*
Mesorhizobium loti MAFF303099 Site: position = -161 score = 5.57557 sequence = AGCTCAACCGCGGTTGAGGT Gene: mlr3125: Permease of the major facilitator superfamily |
|
|
|
|
|
|
|
|
Permease of the major facilitator superfamily |
| CRON 4. | ||||||||||||||||
| PF03992 |
|
|
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -63 score = 6.03762 sequence = ACCTCAGGTTAACTTGAGGA Gene: RL3412: Monooxygenase |
*
Rhizobium etli CFN 42 Site: position = -60 score = 5.98697 sequence = ACCTCAACCATAGTTGAGGA Gene: RHE_CH02961: Monooxygenase |
|
|
*
Mesorhizobium loti MAFF303099 Site: position = -75 score = 6.34985 sequence = ACCTCAACTTAAGTTGAGAT Gene: mlr7819: Monooxygenase |
|
|
|
|
|
|
|
|
Monooxygenase |
| CRON 5. | ||||||||||||||||
| SMc03095 |
*
Sinorhizobium meliloti 1021 Site: position = -59 score = 6.24021 sequence = ACCTCAAGTACGGTTGAGGT Gene: SMc03095: HYPOTHETICAL UNKNOWN PROTEIN |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
HYPOTHETICAL UNKNOWN PROTEIN |
| CRON 6. | ||||||||||||||||
| PF07690 |
|
|
|
|
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -56 score = 5.98697 sequence = ACCTCAACTATGGTTGAGGA Gene: Atu2361: Permease of the major facilitator superfamily |
|
|
|
|
|
|
|
|
|
|
Permease of the major facilitator superfamily |
| CRON 7. | ||||||||||||||||
| PF00903 |
|
|
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -69 score = 5.98184 sequence = ACCTCAACCGATGTTGAGGT Gene: RL4165: Glyoxalase/bleomycin resistance protein/dioxygenase |
|
|
|
|
|
|
|
|
|
|
|
|
Glyoxalase/bleomycin resistance protein/dioxygenase |
| CRON 8. | ||||||||||||||||
| sodB |
Gene: SMc00043: Superoxide dismutase( EC:1.15.1.1 ) |
Gene: NGR_c07300: Superoxide dismutase( EC:1.15.1.1 ) |
Gene: RL1340: Superoxide dismutase( EC:1.15.1.1 ) |
Gene: RHE_CH01203: Superoxide dismutase( EC:1.15.1.1 ) |
*3
Agrobacterium tumefaciens str. C58 (Cereon) Gene: Atu4726: Superoxide dismutase( EC:1.15.1.1 ) Site: position = -96 score = 5.81275 sequence = ACCTCAACCGTGATTGAGGT Gene: Atu4583: Superoxide dismutase( EC:1.15.1.1 ) Gene: Atu0876: Superoxide dismutase( EC:1.15.1.1 ) |
Gene: Meso_0861: Superoxide dismutase( EC:1.15.1.1 ) |
Gene: mlr7636: Superoxide dismutase( EC:1.15.1.1 ) |
Gene: BMEI1367: Superoxide dismutase( EC:1.15.1.1 ) |
Gene: BQ03820: Superoxide dismutase( EC:1.15.1.1 ) |
Gene: RPA1693: Superoxide dismutase( EC:1.15.1.1 ) |
Gene: bll7774: Superoxide dismutase( EC:1.15.1.1 ) |
Gene: BBta_1335: Superoxide dismutase( EC:1.15.1.1 ) |
Gene: Nwi_0913: Superoxide dismutase( EC:1.15.1.1 ) |
2
Azorhizobium caulinodans ORS 571 Gene: AZC_1140: Superoxide dismutase( EC:1.15.1.1 ) Gene: AZC_3053: Superoxide dismutase( EC:1.15.1.1 ) |
Gene: Xaut_3319: Superoxide dismutase( EC:1.15.1.1 ) |
Superoxide dismutase( EC:1.15.1.1 ) |
| fdxA |
Gene: SMc03875: 4Fe-4S ferredoxin, iron-sulfur binding |
Gene: NGR_c32680: 4Fe-4S ferredoxin, iron-sulfur binding |
Gene: RL4616: 4Fe-4S ferredoxin, iron-sulfur binding |
Gene: RHE_CH04024: 4Fe-4S ferredoxin, iron-sulfur binding |
2
Agrobacterium tumefaciens str. C58 (Cereon) Gene: Atu4582: 4Fe-4S ferredoxin, iron-sulfur binding Gene: Atu2751: 4Fe-4S ferredoxin, iron-sulfur binding |
|
|
Gene: BMEI0278: 4Fe-4S ferredoxin, iron-sulfur binding |
Gene: BQ12140: 4Fe-4S ferredoxin, iron-sulfur binding |
|
|
|
|
|
|
4Fe-4S ferredoxin, iron-sulfur binding |
| PF01613 |
|
|
|
|
Gene: Atu4581: Putative flavin reductase |
|
|
|
|
|
|
|
|
|
|
Putative flavin reductase |
| CRON 9. | ||||||||||||||||
| PF00106 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
*
Xanthobacter autotrophicus Py2 Site: position = -145 score = 5.63459 sequence = ACCTAAACCATACTCGAGGT Gene: Xaut_1054: short-chain dehydrogenase/reductase SDR |
oxidoreductase, short-chain dehydrogenase/reductase family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |