Regulon of SoxR in Rhizobium sp. NGR234

Properties
Regulator type:	Transcription factor
TF locus tag:	NGR_c16780
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Rhizobiales
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -31 Score: 6.5 Sequence: ACCTCAAGCTTAGTTGAGGT Locus tag: NGR_c16780 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	NGR_c16780	soxR	Redox-sensitive transcriptional activator, MerR family
Position: -68 Score: 6.5 Sequence: ACCTCAACTAAGCTTGAGGT Locus tag: NGR_c16770 Name: PF03358 Funciton: NADPH-dependent FMN reductase
	NGR_c16770	PF03358	NADPH-dependent FMN reductase
Position: -63 Score: 5.7 Sequence: ACCTCAAGAGCGCTTGAGGT Locus tag: NGR_c15730 Name: PF07690 Funciton: Permease of the major facilitator superfamily
	NGR_c15730	PF07690	Permease of the major facilitator superfamily

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD