Regulon of SoxR in Agrobacterium tumefaciens str. C58 (Cereon)

Properties
Regulator type:	Transcription factor
TF locus tag:	Atu3915
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Rhizobiales
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -91 Score: 6.1 Sequence: ACCTCAACTATAGTTGAGGA Locus tag: Atu3915 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	Atu3915	soxR	Redox-sensitive transcriptional activator, MerR family
Position: -96 Score: 5.8 Sequence: ACCTCAACCGTGATTGAGGT Locus tag: Atu4583 Name: sodB Funciton: Superoxide dismutase( EC:1.15.1.1 ) Locus tag: Atu4582 Name: fdxA Funciton: 4Fe-4S ferredoxin, iron-sulfur binding Locus tag: Atu4581 Name: PF01613 Funciton: Putative flavin reductase
	Atu4583	sodB	Superoxide dismutase( EC:1.15.1.1 )
	Atu4582	fdxA	4Fe-4S ferredoxin, iron-sulfur binding
	Atu4581	PF01613	Putative flavin reductase
Position: -56 Score: 6 Sequence: ACCTCAACTATGGTTGAGGA Locus tag: Atu2361 Name: PF07690 Funciton: Permease of the major facilitator superfamily
	Atu2361	PF07690	Permease of the major facilitator superfamily
Position: -78 Score: 5.3 Sequence: ACCTCAATGGCGCTTGAGGT Locus tag: Atu0942 Name: PF07690 Funciton: Permease of the major facilitator superfamily
	Atu0942	PF07690	Permease of the major facilitator superfamily

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD