Regulon of SoxR in Xanthobacter autotrophicus Py2

Properties
Regulator type:	Transcription factor
TF locus tag:	Xaut_1053
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Rhizobiales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -145 Score: 5.6 Sequence: ACCTAAACCATACTCGAGGT Locus tag: Xaut_1054 Name: null Funciton: short-chain dehydrogenase/reductase SDR
	Xaut_1054		short-chain dehydrogenase/reductase SDR
Position: 26 Score: 5.6 Sequence: ACCTCGAGTATGGTTTAGGT Locus tag: Xaut_1053 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	Xaut_1053	soxR	Redox-sensitive transcriptional activator, MerR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD