Regulon of SoxR in Sinorhizobium meliloti 1021

Properties
Regulator type:	Transcription factor
TF locus tag:	SMc00182
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Rhizobiales
Statistics of regulated genes:
- Genes	4
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -67 Score: 6.5 Sequence: ACCTCAACTATAGTTGAGGT Locus tag: SMc00183 Name: PF03358 Funciton: NADPH-dependent FMN reductase
	SMc00183	PF03358	NADPH-dependent FMN reductase
Position: -59 Score: 6.2 Sequence: ACCTCAAGTACGGTTGAGGT Locus tag: SMc03095 Name: null Funciton: HYPOTHETICAL UNKNOWN PROTEIN
	SMc03095		HYPOTHETICAL UNKNOWN PROTEIN
Position: -62 Score: 5.7 Sequence: ACCTCAACCGCGATTGAGGT Locus tag: SMc01217 Name: PF07690 Funciton: Permease of the major facilitator superfamily
	SMc01217	PF07690	Permease of the major facilitator superfamily
Position: -31 Score: 6.5 Sequence: ACCTCAACTATAGTTGAGGT Locus tag: SMc00182 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	SMc00182	soxR	Redox-sensitive transcriptional activator, MerR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD