Regulon of SoxR in Rhizobium leguminosarum bv. viciae 3841

Properties
Regulator type:	Transcription factor
TF locus tag:	RL4397
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Rhizobiales
Statistics of regulated genes:
- Genes	4
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -29 Score: 6.3 Sequence: ACCTCAACTAATCTTGAGGT Locus tag: RL4397 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	RL4397	soxR	Redox-sensitive transcriptional activator, MerR family
Position: -74 Score: 6.3 Sequence: ACCTCAAGATTAGTTGAGGT Locus tag: RL4398 Name: PF03358 Funciton: NADPH-dependent FMN reductase
	RL4398	PF03358	NADPH-dependent FMN reductase
Position: -69 Score: 6 Sequence: ACCTCAACCGATGTTGAGGT Locus tag: RL4165 Name: PF00903 Funciton: Glyoxalase/bleomycin resistance protein/dioxygenase
	RL4165	PF00903	Glyoxalase/bleomycin resistance protein/dioxygenase
Position: -63 Score: 6 Sequence: ACCTCAGGTTAACTTGAGGA Locus tag: RL3412 Name: PF03992 Funciton: Monooxygenase
	RL3412	PF03992	Monooxygenase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD