Regulog SoxR - Pseudomonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Pseudomonadaceae
- By trascription factor - SoxR
- By TF family - MerR
- By effector - Paraquat
- By pathway - Superoxide stress response
| Genome | Genes | Operons |
|---|---|---|
| Pseudomonas aeruginosa PAO1 | 7 | 4 |
| Pseudomonas entomophila L48 | 3 | 3 |
| Pseudomonas putida KT2440 | 7 | 5 |
| Pseudomonas syringae pv. tomato str. DC3000 | ||
| Pseudomonas fluorescens Pf-5 | 2 | 2 |
| Pseudomonas mendocina ymp | 2 | 2 |
| Pseudomonas stutzeri A1501 | ||
| Azotobacter vinelandii AvOP |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| PF03992 |
*
Pseudomonas aeruginosa PAO1 Site: position = -67 score = 6.39984 sequence = ACCTCAAGTTTGCTTGAGGT Gene: PA2274: Monooxygenase |
*
Pseudomonas entomophila L48 Site: position = -71 score = 6.29081 sequence = ACCTTGAGTTAACTGGAGGT Gene: PSEEN3529: Monooxygenase |
*
Pseudomonas putida KT2440 Site: position = -71 score = 6.14979 sequence = ACCTTGACTTTACTTGAGGT Gene: PP2235: Monooxygenase |
|
*
Pseudomonas fluorescens Pf-5 Site: position = -78 score = 6.12396 sequence = ACCTTGACTTAACTAGAGGT Gene: PFL_4159: Monooxygenase |
|
|
|
Monooxygenase |
| CRON 2. | |||||||||
| PF01042 |
|
*
Pseudomonas entomophila L48 Site: position = -59 score = 6.26331 sequence = ACCTCGACTTAACCCGAGGT Gene: PSEEN2338: Endoribonuclease L-PSP |
*
Pseudomonas putida KT2440 Site: position = -60 score = 6.63583 sequence = ACCTCGAGTTAACTTAAGGT Gene: PP3522: Endoribonuclease L-PSP |
|
|
|
Gene: PST_3684: Endoribonuclease L-PSP |
|
Endoribonuclease L-PSP |
| CRON 3. | |||||||||
| mexG |
*
Pseudomonas aeruginosa PAO1 Site: position = -125 score = 6.87137 sequence = ACCTCAACTTAACTTGAGGT Gene: PA4205: Membrane protein |
|
|
|
|
|
|
|
Membrane protein |
| mexH |
Gene: PA4206: RND transporter, membrane fusion protein |
Gene: PSEEN4758: RND transporter, membrane fusion protein |
*
Pseudomonas putida KT2440 Site: position = -76 score = 6.23299 sequence = ACCTCAAGTAAAGTTGAGCT Gene: PP2064: RND transporter, membrane fusion protein |
|
Gene: PFL_1029: RND transporter, membrane fusion protein |
|
|
|
RND transporter, membrane fusion protein |
| mexI |
Gene: PA4207: RND transporter, membrane fusion protein |
Gene: PSEEN4757: RND transporter, membrane fusion protein |
Gene: PP2065: RND transporter, membrane fusion protein |
|
Gene: PFL_1028: RND transporter, membrane fusion protein |
|
|
|
RND transporter, membrane fusion protein |
| opmD |
Gene: PA4208: RND transporter, outer membrane protein |
Gene: PSEEN4756: RND transporter, outer membrane protein |
|
|
|
|
|
|
RND transporter, outer membrane protein |
| CRON 4. | |||||||||
| PF07690 |
*
Pseudomonas aeruginosa PAO1 Site: position = -83 score = 6.71903 sequence = ACCTCAAGTTAACTTGAGCT Gene: PA3718: Permease of the major facilitator superfamily |
|
|
|
|
|
|
|
Permease of the major facilitator superfamily |
| CRON 5. | |||||||||
| PF03358 |
|
|
|
|
|
*
Pseudomonas mendocina ymp Site: position = -63 score = 6.61342 sequence = ACCTTAAGTTAAGTTGAGGT Gene: Pmen_1342: NADPH-dependent FMN reductase |
|
|
NADPH-dependent FMN reductase |
| CRON 6. | |||||||||
| PF09933 |
|
|
*
Pseudomonas putida KT2440 Site: position = -26 score = 6.32455 sequence = ACCTCGAGTTAAGTCAAGGT Gene: PP2506: Membrane protein |
|
Gene: PFL_0497: Membrane protein |
|
|
|
Membrane protein |
| PF00106 |
|
Gene: PSEEN4636: oxidoreductase, short-chain dehydrogenase/reductase family |
Gene: PP2507: oxidoreductase, short-chain dehydrogenase/reductase family |
|
|
Gene: Pmen_1897: oxidoreductase, short-chain dehydrogenase/reductase family |
|
|
oxidoreductase, short-chain dehydrogenase/reductase family |
| CRON 7. | |||||||||
| soxR |
*
Pseudomonas aeruginosa PAO1 Site: position = -30 score = 6.39984 sequence = ACCTCAAGCAAACTTGAGGT Gene: PA2273: Redox-sensitive transcriptional activator, MerR family |
*
Pseudomonas entomophila L48 Site: position = -34 score = 6.29081 sequence = ACCTCCAGTTAACTCAAGGT Gene: PSEEN3530: Redox-sensitive transcriptional activator, MerR family |
*
Pseudomonas putida KT2440 Site: position = -29 score = 6.01523 sequence = AGCTCAACTTAACTTTAGGT Gene: PP2060: Redox-sensitive transcriptional activator, MerR family |
|
*
Pseudomonas fluorescens Pf-5 Site: position = -50 score = 6.12396 sequence = ACCTCTAGTTAAGTCAAGGT Gene: PFL_4160: Redox-sensitive transcriptional activator, MerR family |
*
Pseudomonas mendocina ymp Site: position = -35 score = 6.61342 sequence = ACCTCAACTTAACTTAAGGT Gene: Pmen_1341: Redox-sensitive transcriptional activator, MerR family |
|
|
Redox-sensitive transcriptional activator, MerR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |