Regulon of SoxR in Pseudomonas fluorescens Pf-5

Properties
Regulator type:	Transcription factor
TF locus tag:	PFL_4160
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -50 Score: 6.1 Sequence: ACCTCTAGTTAAGTCAAGGT Locus tag: PFL_4160 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	PFL_4160	soxR	Redox-sensitive transcriptional activator, MerR family
Position: -78 Score: 6.1 Sequence: ACCTTGACTTAACTAGAGGT Locus tag: PFL_4159 Name: PF03992 Funciton: Monooxygenase
	PFL_4159	PF03992	Monooxygenase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD