Regulon of SoxR in Pseudomonas entomophila L48

Properties
Regulator type:	Transcription factor
TF locus tag:	PSEEN3530
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 6.3 Sequence: ACCTCGACTTAACCCGAGGT Locus tag: PSEEN2338 Name: PF01042 Funciton: Endoribonuclease L-PSP
	PSEEN2338	PF01042	Endoribonuclease L-PSP
Position: -34 Score: 6.3 Sequence: ACCTCCAGTTAACTCAAGGT Locus tag: PSEEN3530 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	PSEEN3530	soxR	Redox-sensitive transcriptional activator, MerR family
Position: -71 Score: 6.3 Sequence: ACCTTGAGTTAACTGGAGGT Locus tag: PSEEN3529 Name: PF03992 Funciton: Monooxygenase
	PSEEN3529	PF03992	Monooxygenase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD