Regulon of SoxR in Pseudomonas aeruginosa PAO1

Properties
Regulator type:	Transcription factor
TF locus tag:	PA2273
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -83 Score: 6.7 Sequence: ACCTCAAGTTAACTTGAGCT Locus tag: PA3718 Name: PF07690 Funciton: Permease of the major facilitator superfamily
	PA3718	PF07690	Permease of the major facilitator superfamily
Position: -125 Score: 6.9 Sequence: ACCTCAACTTAACTTGAGGT Locus tag: PA4205 Name: mexG Funciton: Membrane protein Locus tag: PA4206 Name: mexH Funciton: RND transporter, membrane fusion protein Locus tag: PA4207 Name: mexI Funciton: RND transporter, membrane fusion protein Locus tag: PA4208 Name: opmD Funciton: RND transporter, outer membrane protein
	PA4205	mexG	Membrane protein
	PA4206	mexH	RND transporter, membrane fusion protein
	PA4207	mexI	RND transporter, membrane fusion protein
	PA4208	opmD	RND transporter, outer membrane protein
Position: -67 Score: 6.4 Sequence: ACCTCAAGTTTGCTTGAGGT Locus tag: PA2274 Name: PF03992 Funciton: Monooxygenase
	PA2274	PF03992	Monooxygenase
Position: -30 Score: 6.4 Sequence: ACCTCAAGCAAACTTGAGGT Locus tag: PA2273 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	PA2273	soxR	Redox-sensitive transcriptional activator, MerR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD